ZFIN ID: ZDB-TSCRIPT-090929-7492
Transcript Name: tardbp-201
Previous Name: tardbp-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024674 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024674|OTTDARG00000019917|ZDB-GENE-030131-3777 tardbp|OTTDARP00000020350 tardbp-001 LG_ BX663614.24 Danio rerio protein_coding KNOWN, 2798 bp
TTCCTTCATGACTTAGGTGATGCCATCTTGATTCGAAAAT
AGTGTCGCATGAGTTGTGTGATACGGAGGATTATTGTGTT
TATATTTTATACAGAGATAGCTTTTTGCGTTATTGTAATT
TGAACAGAAAGGGACGCTTTTGAGGGTCGTTCTTGGTCAG
AGTTTTGTTGAGTGGTTCATTCATTCACATTTCTTTTCTG
GACGAGGAGCTGCTGGCGGTGCTAACAAAGGAATAACTGG
ACCCGAGCAGTTGTTTATTGCTCGACTGAGGAAAGATGGC
CGAGATGTACATTCGAGTTGCGGAGGAGGAGAATGAGGAG
CCGATGGAGATCCCGTCAGAGGATGATGGCACGGTTTTGC
TTTCCACAGTGTCCGCTCAGTTTCCAGGGGCTTGTGGTCT
GCGCTTCCGGAGCCCAGTGTCTCAGTGCATGAGGGGGGTT
CGTCTGGTGGACGGCATTCTGCATGCACCTGAGAACGGCT
GGGGAAACCTAGTCTATGTGGTTAATTACCCAAAAGAAAC
TGTTCTGCCAGATAATAAGAGGAAGATGGATGAGATCGAT
GCTTCATCTGCGACCAAGATCAAGAGAGGAGATCAGAAGA
CTTCAGATCTGATTGTGCTGGGTCTGCCATGGAAGACTTC
AGAGCAAGACTTAAAAGACTACTTCGGTACATTTGGGGAA
GTCATCATGGTGCAGGTCAAGCGGGATGTGAAGACAGGAA
ATTCAAAAGGGTTTGGCTTTGTGAGGTTTGGAGACTGGGA
GACTCAGAGTAAGGTGATGACACAGCGGCACATGATTGAT
GGCCGGTGGTGCGACTGCAAACTGCCCAACTCAAAGCAAG
GTATAGATGAACCAATGAGGAGCCGTAAAGTGTTTGTGGG
CCGCTGCACAGAGGACATGACTGCCGATGAGCTCCGTCAG
TTCTTCATGCAGTACGGAGAGGTCACAGACGTCTTTATTC
CCAAACCGTTCAGAGCGTTTGCTTTTGTCACCTTTGCAGA
TGACCAGGTTGCCGCCGCTTTGTGTGGAGAAGATCTGATC
ATCAAGGGCGTCAGTGTGCATATCTCAAACGCTGAGCCCA
AACACAATAACACTAGGCAGATGATGGAGCGGGCAGGGCG
CTTTGGGAATGGGTTCGGAGGTCAGGGTTTTGCAGGCAGC
CGAAGCAACATGGGTGGTGGTGGTGGGGGTAGCTCCAGCA
GCTTGGGAAATTTTGGCAATTTCAATCTAAACCCGGCCAT
GATGGCTGCCGCCCAGGCTGCCTTGCAGAGTAGTTGGGGT
ATGATGGGAATGCTAGCTCAGCAGAATCAGTCGGGTACTT
CAGGCACAAGCACAAGTGGCACCAGTTCCTCTCGAGACCA
AGCCCAAACATATAGCTCGGCTAACAGCAATTACGGCAGC
AGCTCAGCTGCTCTCGGCTGGGGCACCGGCTCTAACTCGG
GCGCTGCCAGTGCTGGCTTTAACTCCAGTTTTGGCTCTAG
TATGGAGTCCAAGTCATCGGGGTGGGGTATGTAAGTGCTT
TGTGTTTGAAGTGTCGGTATTCCTAGCGTGTTTTGGTAAG
TATTTTATTTCGAGAGACTTATCTCATCACGTGTGTTTGG
GAGTGGGGATGGGTGAAAAGAGGGAGTCTGGGGACGAAAC
AAAGAAAAAAAGAATGTTTTGTACACTGAATGGGATTTGA
GTTAGTGTTTGAAGTGAGATGTTAACAAGGGTGCTATGTT
AATGTACCATCTTTGATGTTTAGTTTTTTTCTCCCCAATG
TTGTATTGTCTTGACTGATGCAAACAAAAGCATTTCAACT
GGATTCTTATAATGCATGTTCAATCTGTGAAAATGCATGA
GTTGCATCATTTAATAGTACAAATCAAGAAAAGAAACCTG
CATTGGAAAGAATCTGGTTGAAACCTGAACATGTATATTA
TTGTAAGTTCAGCTTTATTTCAGTCCAGTTGTTTGGAAAT
CCTTTAAAACAAGCCTTCATCAACATCTCTTCTGCAGTTG
ACATCTGTGGGGTTTGCCTGGGAAGAGCGCCCTCTATGGC
AGCACAGTGTGGCTGAGGTCATTATGTCACCTTCCTCCCC
ATGTCTAAATGCTCTCATCGCACGGCTCGATGACACGGTG
GGTGTCTTCTTTTTTAATCCACTTTTTAAAACAAGAAGTG
CGCAAGAAAGTGACCTTTTTTTAAAAAAAAACAACCCTTG
AGTGCGATTGGTGATGGCGAAGAGTGAGAAGGCTGCGAGT
GAGCGAAGAAAGTGTGGAGCGCACGAACGAAAAGACTTGC
GAGTGCAATGAACGAGCCCAAATGTGACTGCAGTGGTGAG
CGTGTGAATGAGAGCTGCTGATTCTTCCCAGCTTCCCCCT
TAATTGAGCCCAAATTGATGGACATTTAGTTCATGTGTAC
TTAAAGAGATATATTTAATTTGTTTTTTGGTCACCCTAGA
TCCCCATTTTGCTTTTTCTCCTTTAGTATACTGACAATGT
GCTTATATAGTTAGTGGAATGTTGTGATGATGATGATGCA
TACTTTGTCTTGCTTCTATAATCCCATCTGAATGCTGTAT
GGTGTGTGTGCTTTATTTCCTTGTAACTTGACCTGTAAGT
GTGAACTTTGATGTGGATGACATCTTCAGTGGACACTGAG
GGGGAAAACATGAGTGATGGTGTAAGTGCGAACTGTATGT
TGAGTGCTGTGGATGTCTGTGGAGTTTCCCTCTAGATTAC
GTCGCTCAGTGTTTTCAGAGGCATTTTATATGACTTGTCA
AATGAAGGGAGTGCTTCAATAAAACTAATTTGAATAGA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tardbp-201 Contained in:
OTHER tardbp-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024674 (1)
  • Ensembl_Trans:ENSDART00000058555 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC049348 (1) 2787bp
    GenBank:CN511138 (1) 929bp
    GenBank:CN511238 (1) 870bp
    GenBank:CT648733 (1) 841bp
    GenBank:CK354558 (1) 828bp
    GenBank:CT719326 (1) 797bp
    GenBank:CV481517 (1) 769bp
    GenBank:DV586181 (1) 767bp
    GenBank:CT692436 (1) 710bp
    GenBank:BQ261204 (1) 664bp
    GenBank:CR929106 (1) 539bp
    GenBank:CB365522 (1) 284bp
    CITATIONS (2)