Transcript

klf17-201

ID
ZDB-TSCRIPT-090929-7422
Name
klf17-201
Previous Names
  • klf17-001
  • klf4-001
  • klf4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024598 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024598|OTTDARG00000019870|ZDB-GENE-010129-1 klf17|OTTDARP00000020293 klf4-001 LG_ BX649271.5 Danio rerio protein_coding KNOWN, 1625 bp
ATATTAGAGACGCATTGTCTGCCTCGGACTGAATGAGAGT
AAACACCTTCTGAGTTCCCTAACATTTGCAACATGGCTCT
TGCAGATGCGATGTTGCCTTCGATAAATACCTTTTCAAAC
AACCACATTTTAGACGAGAAGCAGTCTGAAATAGTTCGGG
ACTGGAAAGTTGATATAGCAAAAACTAACCCAAGGGCTGG
AGACGTGAGACCCCTTATTGAGGTGGAGTTCAGCATTGTC
GAATCTCCACCTTTGGCCAAAGACGAGGATGATCTTTCCA
AGTTTTTGGATCTAGAGTTTATTCTGTCCAACACGGTCAC
GTCTGACAACGACAACACCTCAGCACCGCCGCCCGCCTAT
TCCCTCCCGGAATCACCGGAGAGCTGCAGCACCGTGTATG
ACAGCGATGGATGTCACCCGACCCCTAACGCCTACTGTGG
CACCAACTTCAACTCACGTCCAGGACACAGTCTGGTAGCC
GAACTGTTTACCCCGGACATGAATTATCAGGGCGAATATA
ATCTGAAAGGACATTTAGACAGATTGGAGTACACTGAACT
GAGAGCTCTAAACACACGAAACCAACAACACCTGACCAAC
TCGAATAACGCGGGATATAAAATTAAAACCGAGAACCAAG
AGCAATCCTGTATGATGGTAAACGACTACATGGGTCATTA
TTACGCACAAGAACCCCAGCGCGTAATGCAGCATCAAACG
TACGGGCATCACGTGCAGCAAGATGTGCCTCGGGACATTT
TAGGAAGGAAAGACTGCATCCTGACAGAGATGAACACTCA
GCATCACATTGACATCTCGCATCAACAGCAGTTTATAAAC
AATGCGCATTTTCCACCTCAGTACGCCCAGCATCAACAGT
ACCACGGACATTTTAATATGTTTAGCGAACCACTGCGGGC
AAATCACCCGGCCATGCCAGGTGTGATGCTGACTCCACCA
TCCTCACCTCTCCTGGGATTTTTAAGCCCAGAAGACAGCA
AGCCAAAACGAGGGCGACGCTCTTGGGCGCGCAAAAGGAC
CGCGACGCACAGTTGTGAATTCCCTGGATGCGGGAAAACG
TACACGAAAAGCTCCCATTTGAAAGCGCACATGCGGACGC
ACACAGGTGAGAAGCCCTACCACTGCAGTTGGGAAGGTTG
TGGCTGGAAGTTCGCCAGGTCAGACGAACTGACGCGTCAC
TACAGGAAACACACCGGACACAGGCCATTTCAGTGCCACC
TGTGCGAGAGGGCTTTCTCCCGCTCAGATCACCTGGCTCT
GCACATGAAGAGGCACATGTAAACATAAAGAGAGAGACTA
TATCTATTTTAAGCAACAAGAGGATTTATATCGACGAGAC
AACTCCTATTTTGGGACAGCAGTTATATGTGAATAGCGGT
AAAATGTCATTTGATTTAAATTATGACAGTATTTAATTGA
AGGAGATTCTTGTTCATTTAGAAGGTAAATTATGTAGTAC
TTTTTCAGATGTATAAAAACGGGGCAGGACCCATACTTTT
GTATATATGTTTTTTTTTTTTTGTATTCCCATTTATACAT
TTGTATCAAGTCAGGGAGTATTTTTCATGAATTTTCAGAA
TAATTAAAAGCCTTGCTTTTTTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations