header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7276
Transcript Name: ercc3-201
Previous Name: ercc3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024408 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024408|OTTDARG00000019758|ZDB-GENE-030131-3043 ercc3|OTTDARP00000020153 ercc3-001 LG_ BX927387.10 Danio rerio protein_coding KNOWN, 2759 bp
AAGAGCGTGCTGGACATGGCCGCTCCAGCAGTGTCGTCTG
ATGTGATTCTCGTGCTGCTTTCTTATTAAACATGTGTTAA
ATCATCACTGAATTCACAATAGCAGAGTTATTACTAAAGC
TAAAGCCATGGGGAGGAAAGATAAAAGTGACAGAGACAAG
AAGTCCAAGAAACGCTATTATGAAGACGAAGAGGAGGATG
AAGAGGTGATTGGTGGAGAGTCTCAGGAGGCTGTTCCCGC
AGCTGCTGGGAAACAGGTGGATGAATCCAGCACTAAACTG
GACGAGTATGGAGCCAAAGACTACAGGCTTCAGATGCTCC
TCAAGAATGACCACTCTTCCCGACCTCTATGGGTGGCTCC
TGATGGTCACATTTTCCTCGAAGCCTTCTCTCCAGTTTAT
AAATACGCTCAGGACTTTTTGGTGGCCATTTCAGAGCCGG
TGTGTCGACCCACACATGCGCATGAGTACAAACTGACAGC
GTATTCTCTGTACGCCGCTGTGAGCGTCGGCCTGCAGACC
TCTGACATCATTGAGTACCTGCAGAAACTCAGCAAGACCT
CTGTGCCGGATGGCATAGTGCAGTTTATCAAGTTGTGTAC
AGTGAGCTATGGTAAAGTCAAACTTGTCCTGAAACACAAC
AGATATTTTGTGGAGAGTGCGTTCCCTGATGTCATCCAGC
GGCTGTTACAGGACACTGTGATTCGGGACTGTCGTCTTCG
CTCTGCTGAGGGTGAGGAGACAGAGCTCATCACCGAGACC
ATCTCTAGCAAATCAGCAATCTCAAAGTCTCAGCAGGACA
ACGGTGGTCCATCGTCCTCTCAGCCTGCAGATGGGCAGCG
CTCAGGAACTCAGGTGCCGGAGGACATCTTCAGTTACTAT
GAACAGATGGATAAAGAGGAGGAGGAGGAGGAAGAGACGC
AAACCGTGTCATTTGAGATCCGTCAGGAAATGATAGAGGA
GCTTCAGAAGCGCTGTATTCAGTTGGAGTATCCCCTACTG
GCTGAATACGACTTCCGTAATGACACAGTGAATCCTGACA
TCAACATGGATCTGAAGCCCACCGCTGTGCTGAGGCCGTA
TCAGGAAAAGAGTCTGAGGAAGATGTTTGGGAATGGCAGA
GCTCGATCTGGAGTCATTGTCCTGCCTTGTGGTGCTGGTA
AGTCTCTGGTAGGAGTCACTGCCGCCTGCACGGTACGCAA
ACGCTGCCTAGTTTTGGGAAACTCCTCTGTGTCAGTGGAA
CAGTGGAAAGCTCAGTTCAAGATGTGGTCCACCATCGATG
ACTCCCAGATCTGCCGCTTCACTTCAGATGCAAAGGACAA
ACCCATTGGCTGCTCGGTGGCCATCAGCACCTACTCTATG
CTGGGCCATACCACCAAACGCTCCTGGGAGGCCGAGAGGG
TCATGGAGTGGATGAAGAGTCAGGAGTGGGGACTCATCAT
ACTGGACGAGGTGCACACCATACCTGCAAAGATGTTCCGT
CGTGTTCTTACAATAGTCCAGGCTCACTGTAAACTGGGTC
TCACCGCCACTCTGGTAAGAGAAGATGATAAGATTGTGGA
TCTGAACTTCCTGATTGGACCAAAGCTCTATGAGGCAAAC
TGGATGGAACTGCAGAACAATGGCTACATCGCTAAAGTCC
AGTGTGCTGAGGTGTGGTGTCCCATGTCTCCTGAGTTTTA
CCGTGAATATGTGGCCATAAAGACCAAGAAGAGAATTCTG
CTCTACACCATGAATCCTAACAAGTTTCGAGCTTGTCAGT
TCCTGATCCGCTTCCATGAGCGAAGAAACGACAAGATCAT
CGTCTTTGCCGACAACGTCTTTGCACTGAAAGAATACGCC
ATCCGTCTAAACAAGCCGTATATTTATGGACCCACATCTC
AAGGAGAGCGTATGCAGATCCTTCAAAACTTCAAGCACAA
TCCCAAAATCAATACGATCTTCATCTCCAAGGTAGGAGAC
ACTTCATTTGACCTGCCGGAAGCAAATGTGCTAATTCAGA
TCTCTTCTCACGGCGGTTCTCGACGTCAGGAAGCTCAGAG
ACTGGGCAGAGTGCTGCGAGCCAAGAAAGGAATGGTTGCA
GAGGAATACAATGCTTACTTCTACTCGCTCGTCTCTCAGG
ACACACAGGAAATGGCCTATTCCACCAAGAGACAGCGCTT
CCTGGTGGACCAGGGATACAGTTTCAAGGTAATCACAAAG
TTGGCTGGGATGGAGGAGGAAGACTTAATGTTTTCCACCC
GTGACGAACAGCAGCAGCTCTTGCAGAAGGTTCTGGCAGC
TTCAGATCTTGACGCTGAAGAGGAAGTGGTGATGGGAGAA
GTGGGAGGAAAGCCACAGTTTTCTCGTCGTGCGGGCACTA
TGAGCTCGATGTCTGGAGCAGATGATGCCCTCTACATGGA
ATACCAGATGCCCCGCGGCAGCAAAGCTTCAGTCGGCAAG
AACATTCATCCTCTGTTCAAACGCTTCCGCAAGTGAACAT
ATCACTTGGAGACCCTGAAATCGAATAATATTAAGACACT
CTGTGGCTGCTTGTCTCAGACAGAGCCATTTAAAAAGTGA
GAAAGAAGAAAAACTGCTTTTGTTTTGGAGTAATTTGAGA
GTCTTATGTTTGTAATTGTATTAATGATTTGTTTGAGTTT
GTTATGAGAAACTGAATTGAAAAGAAGGAATAATTTTGTA
CAGTTTTAAAGCTAAAACAGAACCTGCTGTTGAAATGTAT
TGGTAAGCGTTTATCAAATAAAATTTTCAAAACGAATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ercc3-201 Contained in:

OTHER ercc3-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024408 (1)
  • Ensembl_Trans:ENSDART00000013066 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045400 (1) 2780bp
    GenBank:CT719145 (1) 794bp
    GenBank:CT719146 (1) 787bp
    GenBank:BI891104 (1) 763bp
    GenBank:CK024666 (1) 755bp
    GenBank:AW128421 (1) 712bp
    GenBank:AW128669 (1) 560bp
    GenBank:AL924957 (1) 475bp
    CITATIONS (2)