ZFIN ID: ZDB-TSCRIPT-090929-7274
Transcript Name: hoxb5a-201
Previous Name: hoxb5a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024406 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024406|OTTDARG00000019756|ZDB-GENE-980526-70 hoxb5a|OTTDARP00000020151 hoxb5a-001 LG_ BX927395.19 Danio rerio protein_coding KNOWN, 1790 bp
CAGTGCATTGCTATAATTCATTAATACATCATAAATCGTG
AAGCACAGCGTTATAACGACCAAGATCTACAAATCAAGCC
CTCTAAAACAACCTAAATGAGCTCTTACTTTGTAAACTCG
TTCTCAGGGCGCTACCCAAATGGCCCTGACTATCAGTTAC
TAAATTATGGAACTAGCAGCAGCGCTATGAACGCTTCGTA
CAGGGACTCCGGCACCATGCATTCAGGCTCTTACGGCTAC
AACTACAATGGAATGGACCTAAGCGTCAATCGTTCAACCA
GCACTGGCCACTTTGGGGCGGTTGGGGACAACTCCCGGGT
CTTCCAGTCTCCAGCTCCGGAGACGCGATTCCGGCAGCCA
TCAAGCTGCTCGCTCGCGTCTCCGGAGCCGCTGCCTTGTT
CCAACAGCGAAAGCCTTGGACCCAAAGGCTCTTCGCCCCC
TTCCGACCAAAGCACCACCACTGCGGGTAATAATCTCAAC
AGCAACACACATTTTACAGAAATCGACGAGGCCAGTGCTT
CATCGGAGACCGAGGAGGCGTCTCACAGAGCGAACAACTC
TGCACCCCGGACACAACAGAAGCAAGAGACCACGGCAACC
TCCACTACCTCGGCGACGTCCGATGGCCAAGCTCCCCAAA
TATTCCCTTGGATGAGGAAACTACATATTAGCCATGATAT
GACTGGACCAGACGGCAAAAGGGCCCGAACTGCATATACC
CGCTATCAGACGCTAGAGCTGGAAAAAGAGTTCCATTTCA
ATAGATACCTCACCCGAAGAAGGAGGATAGAGATAGCCCA
CGCTCTATGCCTCTCAGAGCGTCAAATTAAGATATGGTTC
CAAAACCGGCGGATGAAATGGAAAAAGGACAATAAACTGA
AGAGCATGAGTCTGGCTACCGCAGGTAGCGCTTTCCAACC
ATAGTTGTATCCCAAGACCTGCTACGTGGTGTGCAAAAAA
TTACGCGGAAAATGAGATGAAAAAGAGATCTCAAAACATT
ACCTACAGAGTACTGTACATCGCGGCACCTTTCGGCATGT
TATGGATGTTTTAGGCATTTTAAAATTCTACTGTGGTACT
GCTATAATGAAACAAAAATTAGTGTTCATATGTTGTTCTT
TTATGGTGACTTTAATTTTGGCAAGTAAATAAAACTGAAG
GGAAAGAAGCTATCAATATAACGCTTGTTGTTCTTGTTAC
AAATATTGTTTATGTGTCAAGTGCTATGTTAATGCTTTCT
TGAGAGTTAGCATGTGAGCTCTTAAATGTTATAACTTATT
TACCTATACACGTGTATAACTACCTTTTGAGTTTACAGCT
TAGAAACGCATCTGCCCTTGTATGAAGTGAAGCTCTAGTT
TAGAGGTGACTGCAGTAAATTTAGCAGAAGCCTATGTTTC
ATGGTCCTCTGTTTAATCAATGTCTAAATAATCACAATCG
ATTTGTCATGTGTTCACAATCTTCTATTATTATTATTATT
TTTTTTTTGAAAAAAAAAAAATAATTAAATGGTGTAAATA
GACCTCGCTAGATTCTTGTACTCGTTCATACGTGTGTATA
GTTGTATTCCAAATATATAATTGTATATTACTGGATCATG
TTTATGTTCCAAAAAAGGTTGTATATATTGAACATTTTTA
TTGTGATCAGTTGGCTATTTGTAGTGGGCAGAATAAACGG
CAATGTGGAAAAAAGTCATGTCAATCTGCCTGTTAGCATT
TTGCCAAAATGCTTTTTGTATTTGTTTGTAGTTTAACTTG
GAGTAAAAAATAAAGTTCCTCATATTCAAA

hoxb5a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA hoxb5a-201 1790
ottdart00000001811 (1) 1953
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxb5a-201 Contained in:
OTHER hoxb5a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024406 (1)
  • Ensembl_Trans:ENSDART00000025449 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071493 (1) 1800bp
    GenBank:CF549657 (1) 822bp
    CITATIONS (2)