ZFIN ID: ZDB-TSCRIPT-090929-7271
Transcript Name: gcdha-002
Previous Name: gcdh-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024403 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024403|OTTDARG00000019753|ZDB-GENE-040426-1855 gcdha|no_translation gcdh-002 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 834 bp
AGTAGCAAGAGAAATCATCTGAGCGAACTAGGCCGGTGAA
GCTTTGTCTCGTCTGCTGGTGAACTCACAGAGATGTCCTC
TGATGTGTGTGTCGAGGGCCCAGGGCACTTTAGCACCTGC
TGCATATGACAAAGAGGAGCGAATCAAAAAAACATCAAAA
CAACCTAAGGTAACCTTTGACTGGCGTGACGCGTTGGATC
TGGAAGGGCAGCTCACAGAGGAGGAGATCATGATCAGAGA
CAGTTTCCGCACATACTGTGAGGACAAGCTCATGCCACGC
ATCATCATGGCCAACAGGAATGAACATTTCCATCGGGAGA
TTTTAAATGAGATGGGAGAGCTTGGTGTCCTTGGGCCTAC
AATTCAAGGATATGGCTGTGCAGGCACTAGTTATGTGGCG
TACGGTCTGATCGCTAGGGAGGTGGAGAGGGTCGACAGCG
GATACAGATCGGTTATGAGTGTCCAGTCCTCACTGGTCAT
GCACCCCATCAATGCCTATGGCACAGAAGAGCAGAAGCAG
AAATATCTGCCTAAACTGGCTCGTGGAGAGATTCTGGGCT
GTTTTGGTCTAACAGAACCAAACCACGGAAGTGACCCCGC
TGGAATGGAGACTAAAGCCAAATACAACCCCTCCAGCAGA
ACTTACAGCATCAGTGGGACAAAAACATGGATCACCAACT
CTCCGTATGCTGATATCTGTGTGGTGTGGGCAAAATGTGA
GGATGGCAAAGTGAGAGGGTTTGTCCTGGAGAGAGGGATG
AAGGGGTTGAGCACCCCGAAAATAGAGGGCAAATTCTCCC
TCAGAGCTTCAGCCACCGGGATGATTGTGATGGA

gcdha TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gcdha-002 834
mRNA gcdha-202 (1) 1970
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gcdha-002 Contained in:
OTHER gcdha-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024403 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT866359 (1) 882bp
    CITATIONS (1)