ZFIN ID: ZDB-TSCRIPT-090929-7270
Transcript Name: gcdha-202
Previous Names: gcdh-001, gcdha-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024402 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024402|OTTDARG00000019753|ZDB-GENE-040426-1855 gcdha|OTTDARP00000020148 gcdh-001 LG_ CR394534.6 Danio rerio protein_coding KNOWN, 1970 bp
AAAGATGGACGACTCTTTCTTCCAATTTGCGACACGTTCA
CGCAGCTCAGCTCTGAACATAAATAGTATTACAGTAGCAA
GAGAAATCATCTGAGCGAACTAGGCCGGTGAAGATTTGAA
CATCACCAACCATGGCATTAAAAACAGCTTTGTCTCGTCT
GCTGGTGAACTCACAGAGATGTCCTCTGATGTGTGTGTCG
AGGGCCCAGGGCACTTTAGCACCTGCTGCATATGACAAAG
AGGAGCGAATCAAAAAAACATCAAAACAACCTAAGGTAAC
CTTTGACTGGCGTGACGCGTTGGATCTGGAAGGGCAGCTC
ACAGAGGAGGAGATCATGATCAGAGACAGTTTCCGCACAT
ACTGTGAGGACAAGCTCATGCCACGCATCATCATGGCCAA
CAGGAATGAACATTTCCATCGGGAGATTTTAAATGAGATG
GGAGAGCTTGGTGTCCTTGGGCCTACAATTCAAGGATATG
GCTGTGCAGGCACTAGTTATGTGGCGTACGGTCTGATCGC
TAGGGAGGTGGAGAGGGTCGACAGCGGATACAGATCGGTT
ATGAGTGTCCAGTCCTCACTGGTCATGCACCCCATCAATG
CCTATGGCACAGAAGAGCAGAAGCAGAAATATCTGCCTAA
ACTGGCTCGTGGAGAGATTCTGGGCTGTTTTGGTCTAACA
GAACCAAACCACGGAAGTGACCCCGCTGGAATGGAGACTA
AAGCCAAATACAACCCCTCCAGCAGAACTTACAGCATCAG
TGGGACAAAAACATGGATCACCAACTCTCCGTATGCTGAT
ATCTGTGTGGTGTGGGCAAAATGTGAGGATGGCAAAGTGA
GAGGGTTTGTCCTGGAGAGAGGGATGAAGGGGTTGAGCAC
CCCGAAAATAGAGGGCAAATTCTCCCTCAGAGCTTCAGCC
ACCGGGATGATTGTGATGGATGAGGTGGAGGTGCCAGAGG
AAAACCTGCTGCCCCACGTGTCTGGCCTAGCTGGGCCCTT
TGGCTGCCTGAATAATGCCCGCTTTGGCATTGCGTGGGGC
GCTCTGGGTGCTGCTGAATTTTGTTTCCATGCTGCTCGTC
AGTACACCATGGACAGAATCCAGTTTGGCGTCCCTCTCGC
CAGAAACCAACTCATCCAGAAGAAGATGGCAGACATGCTG
ACAGAAATTACAATCGGCCTGCAGTCCTGTTTACAACTGG
GCAGACTCATTGACCAAAAAAAACACACACCAGAGATGAT
CTCCCTGCTGAAGCGAAACTCATGTGGTAAAGCCCTGGAC
ATCGCCAGACAGGCCAGAGACATGCTGGGAGGAAACGGCA
TAGCAGACGAATACCACATCATACGGCACGTCATGAACCT
AGAGGCCGTCAACACATACGAAGGCACTCATGACATTCAT
GCGTTGATTTTGGGCAGAGCCATCACTGGACTCCAGTCTT
TTACTGTTGGAAAATAAACCCATAGTTCTTTCTGAACGTA
ATCATAAAGCACTTTTGCGTCTGTCTCTGAAACGAGGGAA
ACTTTATCAACACCATTCTTCCATCTCTGTATAACCTCAA
ATGATTTGATTCGAGTGTGGGTCCAAACTGAAATCTGCTT
CTTCTGTGTCTGCTATCTGAGGGTACTGATCTGACATCTA
TTAATATGTCATGTTACAAAGACGCTTGCATTAAGAAGGG
GTTCATGATCTTGATGTGTATTAATTTTTGAAAGCATTCA
TCCATGGGATTTATGGATAACAATGTCATGAGAATGATGA
AAGATAATCTATATCAGTTTTAAAGCTCCGCTTTTCTTGA
TGTCAGACATCCTGCTTGCACTTTAGAGATAACTCTGACC
CACTGATCACTGTCAATACAAGTATTAAAAATGATGAATT
TGATAAAATAATTCAACATTGTTATATTTATTGAGTGCTG
GAAGCCACAGTGACTATTCTTTCATTGTCAATAAAGTCCA
ATTTGTTTTA

gcdha TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gcdha-002 (1) 834
mRNA gcdha-202 1970
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gcdha-202 Contained in:
OTHER gcdha-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024402 (1)
  • Ensembl_Trans:ENSDART00000147793 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC063972 (1) 1904bp
    GenBank:CK872929 (1) 824bp
    GenBank:DN903646 (1) 790bp
    GenBank:CN506383 (1) 774bp
    GenBank:DN836094 (1) 747bp
    GenBank:DY554068 (1) 719bp
    GenBank:BQ260809 (1) 684bp
    GenBank:CK699094 (1) 676bp
    GenBank:BQ261129 (1) 670bp
    GenBank:BG883869 (1) 564bp
    GenBank:AL923090 (1) 534bp
    GenBank:AL914065 (1) 474bp
    GenBank:CK684934 (1) 458bp
    GenBank:CT593332 (1) 433bp
    CITATIONS (2)