header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7068
Transcript Name: vldlr-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024185 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024185|OTTDARG00000019638|ZDB-GENE-040426-803 vldlr|no_translation vldlr-003 LG_ CR628386.8 Danio rerio protein_coding KNOWN, 752 bp
ACAAATTAACAAACATTCCCCTAAATACACCTGCGTGTGT
CCGGAAGGCCAAACCCTGGCCTCAGATGGCTTGCGCTGCA
GAGCAGGTACGCAACGCATCTCTTTATAATGTGAAACAAT
GTAAAGCTAAACAAGCTTTCATTTGCACTGTTACATGTTT
GTCATTCATGATCCATTTTTGTTGGTCATCTTTGGTCCTT
AAAAACAATCACAATTGACCTGAGAGGGCTAAGAATTGGC
CATTTTATTGCTTTGGCTGTATTGATCTTTTATGACAGAG
GCAACTTCTGCCGCCCCTCAAGATGGAGGGCAGGTAACTA
CTCGCCCCAGTCACCCAAAAGCATCTTCAGTCTCGAAGGT
TGCCTCTGAACCAGTTCATACTGAAGGAAACCTAAGCACC
TCCATACATGAGGTCAATACATCAGCCAGAGGATCTGCTG
CTGCCTGGGCGATTCTACCTGTGTTATTATTGGCCATGGC
AGCTGCTGGTGGTTACTTAATGTGGCGCAACTGGCAGATC
AAAAACAAGAAGAGCATGAACTTCGACAACCCAGTGTATC
TGAAGACCACAGAGGAAGACCTCAATATCGATATCAGTAG
ACACAGCGCTTCTGTAGGCCACACGTACCCTGCTATCTCA
ATGGTAAACACAGAAGATGACTTGTCATAACCCAAGCCCC
CCCCCCCTACAATGCTCCGGTTTATTTAGTAGCCACTTGG
CACCAATGGCAACTGCTGCCGTTTCGACGGTT

vldlr TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA vldlr-002 (1) 921
vldlr-003 752
mRNA vldlr-203 (1) 3496
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vldlr-003 Contained in:

OTHER vldlr-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024185 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK027514 (1) 752 bp
    CITATIONS (1)