header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7066
Transcript Name: vldlr-203
Previous Name: vldlr-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024183 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024183|OTTDARG00000019638|ZDB-GENE-040426-803 vldlr|OTTDARP00000020007 vldlr-001 LG_ CR628386.8 Danio rerio protein_coding KNOWN, 3496 bp
TTTTTTCCCGTTTGTCCCACGAAGACATATCGGCGGTGTT
ACAATATCAGGGACGAGGCCACAGACAGACAGACAGACAG
ACAGCCCGGCGGTCAGCTCTAGCGCGAAATGGTCAGGTCT
ATGCTGGGGCTTCTTCTCCTCCTGCCAGTATGTTTTCAGC
TGTGGGGATTTTCGCGCGCTTCCCGAGCAGAATGTGAGCA
GTCTCAGTTCCAGTGTGGAAATGGCCGGTGTATTCCGTCT
GTGTGGCAATGTGATGGGGACATGGACTGTTCGGATGGCA
GCGACGAGACGTCCTGCGTGAGGAAAACTTGTGCCGAGGT
GGACTTTGTCTGTCGCAGTGGACAATGCATCCCCAAAAGA
TGGCAATGTGACGGGGAACCTGACTGCGAGGACGGCTCAG
ACGAAAGCATCGAAATGTGCCATACGCGAACCTGTCGAGT
GAATGAATTTAGTTGTGGTGTCGGCTCCACACAGTGCATT
CCCGTCTTCTGGAAGTGTGACGGTGAGAAAGACTGCGACA
ACGGAGAGGACGAGATTAATTGTGGTAACATTACATGTGC
CCCTCTGGAGTTCACCTGTTCCAGTGGCCGCTGTGTTTCT
CGTAAATTCGTCTGCAATGGTGAAGATGACTGCGGTGACG
GCAGCGATGAACAGGACTGCGCTCCTTCCTCCTGCAGCCC
AAGCGAAATCCCTTGTGGGAACAATACGTGTATTCCTAGA
AGCTGGTTATGTGACGATGATGTAGACTGCCAAGATCAGT
CGGATGAGTCCCCAGAGCGCTGCGGCCACAACCCGACGCC
TCCGGCCAAATGTTCGCCCAGCGAGATGCAGTGCGGCTCT
GGCGAATGCATTCACCGGAAGTGGCGCTGCGACGGAGACC
CAGATTGCAAGGATGGCAGCGACGAGAAAAACTGCTCTGC
CCGTAACTGCAGACCTGACCAATTCAAGTGTGATGACGGC
AGCTGTATCCATGGCAGCCGACAGTGCAATGGATTCAGAG
ATTGTGTGGATGGAACAGATGAAGTCAACTGCAAAAACTT
AACTCAATGTAACAGTTCTGACCAGTTCAAGTGTCGAAGT
GGAGAGTGCATTGAGATGAGTAAAGTGTGTAATAAGGTCC
GTGACTGTCCCGACTGGAGTGATGAACCCATCAAAGAGTG
CAATATGAATGAATGCTTGATCAATAACGGAGGCTGTTCG
CACATCTGTCGAGACTTGACGATTGGCTTCGAATGCGACT
GCACACCGGGACTCCAGCTCATCGATCGCAAGACCTGCGG
TGATGTCAACGAGTGCCTCAACCCAGGGATATGTAGCCAG
ATATGTATAAATCTTAAAGGAGGATACAAATGCGAGTGTC
ACAATGGTTACCAGATGGACCCCACCACTGGAGTGTGCAA
AGCTGTTGGTAAAGAGCCCTGTCTTATTTTCACCAATCGA
AGAGACATCCGTAAACTTGGCCTGGAGCGCCGTGAATATA
CTCAGATTGTGGAGCAACTGCGGAACACTGTAGCTCTTGA
TGCCGACTTCATTCAGCAGATGATATTCTGGGCTGACCTG
GGCCAGAAGGCCATTTTTAGCACAGTGTTGGATAAGCAGG
ATGAAAGTCATAAGAAAGTGATTGACGATGTTCAGATGCC
TGTTGGGATTGCAGTAGACTGGATTTACAAAAACATCTAT
TGGTCAGATCTGGGAAGTAAGAGCATAACTGTGGCCAACT
TCAATGGGACCAAGAAGAAGGTGCTTTTTAACAGCGGCCT
GAAGGAACCAGCCTCTATTGCTGTAGACCCTCTATCAGGG
TTCCTCTATTGGTCAGACTGGGGTGAGCCAGCTAAGATTG
AGAAGTCTGGTATGAACGGGAATGACAGACAGGTCCTTGT
TGAGACGGACATTCAATGGCCCAATGGAATCACTCTTGAT
TTGATCAAGGGAAGGCTCTACTGGGTGGATTCCAAGCTGC
ACATGCTTTGTAGCGTAGACTTGAATGGAGACAACCGTCG
GAAGGTGCTACAGTCTCCTGATTACCTGGCACATCCTTTT
GCTCTTACTGTTTTTGAGGATCGAGTGTTCTGGACAGATG
GTGAAAATGAGGCAATCTATGGGGCGAACAAGTTCACAGG
ATCTGATGTAACTTTGCTGGCCAGCAACCTCAATGAACCC
CAGGATATCATCGTGTACCATGAGCTAATTCAGCTGTCTG
GGACTAACTGGTGTAATGAAAAGATGGAGAATGGAGGCTG
TTCCTTCATGTGTCTACCAGCTCCACAAATTAACAAACAT
TCCCCTAAATACACCTGCGTGTGTCCGGAAGGCCAAACCC
TGGCCTCAGATGGCTTGCGCTGCAGAGCAGAAGGAAACCT
AAGCACCTCCATACATGAGGTCAATACATCAGCCAGAGGA
TCTGCTGCTGCCTGGGCGATTCTACCTGTGTTATTATTGG
CCATGGCAGCTGCTGGTGGTTACTTAATGTGGCGCAACTG
GCAGATCAAAAACAAGAAGAGCATGAACTTCGACAACCCA
GTGTATCTGAAGACCACAGAGGAAGACCTCAATATCGATA
TCAGTAGACACAGCGCTTCTGTAGGCCACACGTACCCTGC
TATCTCAATGGTAAACACAGAAGATGACTTGTCATAACCC
AAGCCCCCCCCCCCTACAATGCTCCGGTTTATTTAGTAGC
CACTTGGCACCAATGGCAACTGCTGCCGTTTCGACGGTTT
CACAACCAGCTGCCTTCTGAAATGCATTTTCAAGTTTTGC
CCCCACCCCCCAAATCCCAATCAGAGGATGTCATTTGTGG
TACAAGAAAGTATATGCATCCCGCTCAGGCTGAGTGTGCT
CCAAAAGCATCAAGGAATTCCATTGGGATTATGATTTTAA
CTTCACGTACACCATAGAAGGCCCAAAAATGATTCAACAG
CCGTACGTCCTACTTGCAAGGATGTTAGCATTAACTCAAG
AACCAGAACGCTGAGTAGATGGCTAGTAGTGTGTGTGGAT
GCCTGAAATATTTAAATGAAAATGCATATTTTAGATGGCC
ATGTCTTTAAGATGTAAGTTTCTTTCTTTCTCATGATGAA
CATTGTTTCCCAGAGATGCTTCGTGAGTCTTGCTGGGATA
AAAAAAATGCTCTATGGGGAAAAGTGCTGTTACGACGTTT
GTAAAACATTGTGTATATATATCCCTCTCTGGAAAAAAAC
AAACATAATCAGGATTCCTCAAGCACTTTGATCAAATGTT
CCTCTGTAAATAAGATTGTATACATTTGACTGAGACAATT
TTGCTATGGTTGGGCACTGTACCAGGGTAGAGGTTGACAT
ATTTAAAAAAAACACAAAAAAAAAATGGAGTTTGTTAAAC
CTATTTTGTATGTTTGTGTGCTGTTCCTGTGACCTTTTAT
AGCAGTGTACAGGGGGACGAAATGCTCTGTATTGTGAAAA
GGAAACATTTGCAAACGTAAAATAAAATTAAAGTTTAAAT
TATGCTTCTTTGTTAA

vldlr TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA vldlr-002 (1) 921
vldlr-003 (1) 752
mRNA vldlr-203 3496
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vldlr-203 Contained in:

OTHER vldlr-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024183 (1)
  • Ensembl_Trans:ENSDART00000139047 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC047187 (1) 3516 bp
    GenBank:CA474077 (1) 981 bp
    GenBank:CN838890 (1) 864 bp
    GenBank:CK016301 (1) 855 bp
    GenBank:DY560407 (1) 728 bp
    GenBank:DY548602 (1) 714 bp
    GenBank:BM265553 (1) 562 bp
    GenBank:BM102914 (1) 543 bp
    GenBank:CD584972 (1) 344 bp
    CITATIONS (2)