header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7031
Transcript Name: glula-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024147 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024147|OTTDARG00000019618|ZDB-GENE-030131-688 glula|no_translation glula-002 LG_ BX323553.3 Danio rerio protein_coding KNOWN, 780 bp
GAGAGAACATCAAACACATAATATCCATTAAACTAAGTGG
ACAATCCACTCCTATTTTATACATTTTATTTTCTGTTGGT
GTCAAGGTGTTTTATAGTAATAAAAATGGCCACGTCTGCC
AGTTCTCAGTTGAGTAAAGTGGTAAAACAGCAGTATATGG
AACTGCCTCAGGGAGACCAAGTACAAGCCATGTATATCTG
GATAGATGGAACCGGAGAAGGACTACGATGCAAGACCAGA
ACACTGGACTCTGAACCCAAAAGCATTGAAGATCTTCCTG
AGTGGAACTTTGATGGTTCCAGCACGTATCAAGCTGAAGG
CTCCAATAGTGACATGTATCTCATCCCAGCTGCTATGTTC
AGGGATCCTTTCCGCAAAGACCCCAACAAACTGGTTTTGT
GTGAGGTTGTCAAGTACAACCGGAAAACTGCAGGTACATT
CGAGAGGGGGTAAAAAGTAGAGAAAATATATAAATATTGT
TCAAAGTTTGTTTAGACTTATTGCTACTCCAATTTTAACC
ACAGAAACCAACCACCGTCATACATGTAAAAAGATCATGG
AAATGGTAGGACATCAAAGCCCTTGGTTTGGGATGGAGCA
GGAGTACACTATTCTGGGTACTGACGGACACCCCTTTGGT
TGGCCTTCCAATGGGTTTCCTGGTCCTCAAGGACCTTACT
ACTGTGGAGTTGGAGCAGATAAAGCCTATGGCAGAGACAT
CGTGGAGGCGCATTACAGAGCCTGCCTATATGCCGGTGTG
ATGATTTGTGGAACCAATGC

glula TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA glula-002 780
glula-003 (1) 435
mRNA glula-202 (1) 1974
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
glula-002 Contained in:

OTHER glula-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024147 (1)
  • Ensembl_Trans:ENSDART00000172148 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DT069132 (1) 779bp
    CITATIONS (2)