ZFIN ID: ZDB-TSCRIPT-090929-6950
Transcript Name: pcna-201
Previous Name: pcna-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024022 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024022|OTTDARG00000019528|ZDB-GENE-000210-8 pcna|OTTDARP00000019885 pcna-001 LG_ BX001050.4 Danio rerio protein_coding KNOWN, 1445 bp
AGTGGGTCAGTTTAACAAAATCCCGGCGAAAGCGCGCGCA
GTTACATTCAGAGCCTCGCCAGAACAGTGGACAGCACATC
TGCACCGTGCCTCCTCTGCATTAGTACCTGCTAAACTCTA
GGATAGTTTAGGATTCTGCTTTCCTGTGCTGGAAAACAAG
CAGTTAACCAGGCCGCAGCTTGTGTCGTAACAGGATTAGA
TAACTTTAGTTCCTCCTACTCTAAACTAAGAAAGCAGCAC
AATGTTTGAGGCACGTCTGGTTCAGGGATCTATCCTTAAG
AAGGTCCTGGAGGCTCTGAAAGACCTGATCACCGAGGCTT
GCTGGGATGTGAGCTCGTCGGGCATTTCTCTGCAGAGTAT
GGACTCCTCTCATGTGTCTCTGGTGCAGCTGACGCTCCGG
AGTGACGGGTTCGACTCCTACCGCTGCGACAGAAACCTAG
CCATGGGGGTCAATCTGAGCAGCATGTCGAAGATTCTGAA
GTGTGCTGGAAATGAAGACATCATCACACTCAGAGCTGAA
GACAATGCTGACGCCTTGGCACTGGTCTTTGAAACGCTCA
ATCAAGAGAAAGTGTCCGACTATGAGATGAAACTGATGGA
TCTGGATGTGGAGCAGCTTGGCATTCCAGAGCAGGAATAC
AGTTGTGTGGTGAAGATGCCGTCGGGTGAGTTTGCCCGCA
TCTGCAGGGATCTGTCACAGATTGGTGATGCTGTCATGAT
CTCGTGTGCCAAGGATGGCGTGAAGTTCTCTGCCAGCGGA
GAGCTGGGCACAGGCAACATCAAGCTCTCACAGACCAGCA
ACGTCGACAAGGAGGATGAAGCGGTAACAATTGAGATGAA
TGAGCCAGTGCAGCTCATTTTTGCATTGAACTACCTGAAC
TTCTTCACCAAAGCCACTCCTCTGTCCAAGACGGTCACAC
TTAGCATGTCCGCAGATATTCCACTAGTGGTTGAGTACAA
AATTGCAGACATGGGACACGTCAAATATTACCTGGCGCCC
AAGATCGATGAAGAGTCCTCCTAAATCCAAGCAGAAGAGC
GGAGCCTGTCATCTGTGGGATTTCATTCTGGATCTCAGAA
GTTATTGCATAGATGTTTTGGGAAAATGCATTTTATCACT
CAGTGTCTGCTGTGGTTTCCAGTTCAATGGATTCCCGATT
GTGACCCTCTAAAGCCATTACATATCATTGGCAGAATTGC
GGGCGCACTTATTAAATGATGGTAGTTTGGGCCTTAGCTT
TACCAGGCGCTCCGTGGGCTGAATCTAGAGTGCTCTCATG
TACATACTCCACATTCAGTCTTGTTTTTCTCCTCTTTGCC
GTTGTCCTCTTGTGTCCATTTCAGGTTTTGTCCAACTGCT
CATTCCAATGTGTAGATAATTGTCTGTAAATATGCTAATT
GGACACCGTTCATCCAGTCAACCCTTAATAAAACTTTTGT
ATCGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pcna-201 Contained in:
[BAC] CH211-139N6 (1)

Genome Resources: Vega_Trans:OTTDART00000024022 (1),  Ensembl_Trans:ENSDART00000076304 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049535 (1) 1426 nt
GenBank:BC064299 (1) 1410 nt
GenBank:CN020242 (1) 930 nt
GenBank:CT693735 (1) 855 nt
GenBank:CN019468 (1) 811 nt
GenBank:CK870983 (1) 810 nt
GenBank:CT690894 (1) 782 nt
GenBank:CV481940 (1) 734 nt
GenBank:BQ479805 (1) 641 nt
GenBank:BM316461 (1) 414 nt
CITATIONS (2)