header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6889
Transcript Name: pmm2-201
Previous Name: pmm2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023954 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023954|OTTDARG00000019488|ZDB-GENE-030722-6 pmm2|OTTDARP00000019840 pmm2-001 LG_ BX927386.11 Danio rerio protein_coding KNOWN, 1394 bp
ACTTACATATAAATTTGAATTGGTCGCATTGTCATTCACT
ACAATAACAACGTGGCCCATACATAGGGAAAACAGGTTAT
CCTTCTTATTTATGAAGTTGTTTGTCTGCTGTTGGCAGAT
GTTGTACACGTGGAGGTCGCTCACTCTGACGTACAGCTCT
GGCGCTTCAATACACTTCCGACAACACGGAAGATGTGACG
TTGCACTGCTGAATGAATGAACTGACTGCCACTGAGTCTT
CATAAAACTTCATACAGAGGAGATATTGATTTCTAAAGTT
TCCAAATATCACAATGTCTGGTTCTACCGTGGATTCGACA
ACGCTGTGTCTGTTTGACGTGGACGGGACTTTAACAGCAG
CTCGTCAAAAAGCCACCGCAGACATGCATGAGTTTCTGTC
TAAACTGAAACAGCGTGTGAAAGTCGGAGTGGTTGGAGGA
TCAGATCTGGACAAAATCAAAGAGCAGCTTGGAGATGATG
TGATTGACAGAGTGGATTACGTGTTTGCTGAGAACGGTTT
GGTTGCGTACAGGTTTGGAAAGCTTCACTCTGTGCAGAAT
ATTCAGGCCTACCTGGGAGAAGACATTTTGCAGGAATTCA
TCAATTTCTGCCTCAATTACCTTTCAAAGATTAAACTGCC
TAAAAAAAGAGGCACATTTATTGAATTTCGGAATGGAATG
CTGAATGTCTCTCCGATCGGTCGAAGCTGCAGCCAACAGG
AAAGAATCGAATTCTTTGAACTTGATAAGAAGGAGAAGAT
TAGAGAAACATTTGTCTCCGTTTTAAAAGAAGAGTTTGCT
GGGAAGGGACTAGCTTTCTCCATTGGTGGACAGATCAGTT
TTGATGTGTTTCCAGAAGGCTGGGATAAGCGCTACTGTTT
GGGAATTGTGGAGAAAGACTCCTATCAGCACATCCATTTC
TTTGGAGACAAAACAATGCCTGGAGGAAATGACTACGAAA
TCTTTGTAGACCCCAGAACAATCGGCCATGAGGTCAAATC
TCCTGAAGACACACAGAGGATCTGCAGGGAGCTCTTTTTC
AGCTGAGAAAAGACCCTGAACACAACCTCTGCTATCTAGA
ATGAAGTATACAGAAGACTACACTGTCTATGAATCGTGAA
ACTATGAATGAAAGTCTCACTATTGACTTTATTGTCTTGT
ATATGCACATGCTTGTACCTCATGACAGGTGCTTATGATA
AATCTGGGTTACTGTGTACAGTATGCATTTATTTTTATAG
GTAATGTTATGCATTACATACAGCTTTAAGGATCATTGTG
GGTGCTAGGGTCATTATGTCTGAACTCCTGTGCCTTAAAT
CACATCAGTACTGGACATTCTAAAATCTTCTATTGATATT
AAACACATTATAATCCAAATAAAAGGGAAGATCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pmm2-201 Contained in:

OTHER pmm2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023954 (1)
  • Ensembl_Trans:ENSDART00000054848 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC051778 (1) 1259 bp
    GenBank:EH567111 (1) 838 bp
    GenBank:BC165111 (1) 820 bp
    GenBank:BM182197 (1) 652 bp
    GenBank:BI868034 (1) 527 bp
    GenBank:BM037193 (1) 438 bp
    CITATIONS (2)