header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6883
Transcript Name: arl11-201
Previous Names: arl11-001, ottdart00000023948

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023948 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023948|OTTDARG00000019483|ZDB-GENE-030131-3410 arl11|OTTDARP00000019835 arl11-001 LG_ BX294379.5 Danio rerio protein_coding KNOWN, 1914 bp
CGTGTCGCTTCTCCTTTTTCACAGGATTTCCTTCAAAAAC
AGAAGCTGAAACCTTAAGACTCCGATGCCCTGCAGAGGAA
TCAACCCTTCGTAAGCTCATCCAGGATCCAAAATGGGCGC
CATCAAGTCCAAACGGTTTAAAAAGCCTCCTCAGGTGCTC
ATCATGGGCTTGGATTCAGCAGGAAAATCTACTTTAATGT
ACAGGCAGCTGCACGGGGTCATCATGCAGACCTCGCCCAC
CGTGGGCTTCAATGTGGCGACCCTCCAGCTGAACAAGAAG
ACCTCCCTGACCGTGTGGGACATTGGAGGGCAGGACACCA
TGAGGCCCAACTGGAAGTACTACCTGGAGGGATGCAAAGT
GCTAGTGTTCGTGGTGGACAGCAGTGATTACGCCAGGATC
GGAGAAGCTCAGAAAGCCCTCAAGAAGATCCTGCACGATG
AGCATCTTAAAGGGGTTCCCCTGATGGTGCTGGCCAACAA
AAAGGACCTGCCGAACACCATGACTATCAGAGAGGTGTCC
ACCAAGCTGGATTTGGACACTTACACGGATCGCCAATGGG
AGATTCAAGCCTGCAGCGCTGTGAAGGGTCTGGGTCTCCA
ACAAGCCTTTCTGTCTATAGCTAAACTACTGCAGAAAGCA
TGAGGACTGGGAAATGTGACGCAGTTTAAACTTATTATAG
TATATGTTAATGACACTTTATTCGTGTTATTATACAGGTA
ACACTTTAAAATAAGGCTGTTTTAGTTAATGTTACTTGGC
AAACAATGAACAATATATTTATTATGTTTGTTTGTTAAAG
AAAATAAAGAGATTTACTGTTCGTGTTAACTCGCAGTGCA
TTAACTATTGTCAACAAGCATGAACTTGGAATTTAAAGGA
CACCTAATTTTACCCTTTATAAGACGTAAGGTAAGCCTTT
GGTGTCTCTAGAATGTGTCTATAAAGTTTCTGCTGAAAAT
ACCCATCACAATATTTATTATAGCCTCCAGAATCTGCCCA
TTTTGGTGTCTGAATACAGTGTAGCTGTTTTTGTAGCCTG
TGGCTTTAAATGCAAATGAGCTGCTTCTCCCCGCCCATCG
TTTCCATGTGCGCATCTGCTTCTTTCGCCCCATGCACTCT
GGACTTCAGCGTCAACGAGTGTCTGAAGTTGGGGCTGACG
TGATCAGGCCCGGCCCTAACCAATTTGGCACCCTAGGCAA
AATTTCAGGTGGCACCCCGTCACATCGCAGTAAATTCCAA
TGCTAGTGTATAGTCATAAATAGCTTTTTGATCGACAACT
ACAAGCAGGGAAAACGTCAGATAAATATGCCAATGCAATT
AATGTTATTGCTGAATAGATTTAATATTTACACATTTGCA
TGAGGATGTAATGATGGGGGTATACATTATATTGAATAAT
AGGAACCATTTTTTATTATTTTTTGTCTCTTTTCTTTTAA
TCAAACAATTATTTGTATTGGTCATGTAAGTGTCATATAT
TAACTGAATTTCTAATGTTGTGGGTGAGTGCTGTGCATAC
TAATTAGCATTTTTGCAGAAGTAGATAGATGCGGGTCCAA
AATTAAATTCAGCTCTGCAGAAACTTCCTGTCTGAAGAGA
GGTGTTAAAACTGAACACAGAACACAGAAAAATGTATACT
TTGTTGTTGGGCAGAGAATTCATAGAAAAAGAGGAAGTAT
GCCGAAGGGGCAGCCAATGGAGGACTGAACAATGACTGAC
AAGTGACGTTACACCAAAACTCCACCTGTTAAGATCGGTG
GTGTATATATGCTGAAGTCAGGAAATATATGTTAGTTGCG
AACCTCTTGAATGTAATTCTTGTATTGCATTGGGGTAATG
TAACCCAGAGCTCTGTCATCGAATTATTCATTTGTATCCA
ATAAATTGTTACGATTTTTGACATTGAAGAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arl11-201 Contained in:
[BAC] DKEY-7A20 (1) (order this)

OTHER arl11-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023948 (1)
  • Ensembl_Trans:ENSDART00000053221 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC045903 (1) 1917 bp
    GenBank:DV589924 (1) 779 bp
    GenBank:BM101873 (1) 628 bp
    GenBank:CR927366 (1) 539 bp
    CITATIONS (2)