header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-670
Transcript Name: rps7-201
Previous Name: rps7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006213 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006213|OTTDARG00000005705|ZDB-GENE-040426-1718 rps7|OTTDARP00000005528 rps7-001 LG_ BX276180.5 Danio rerio protein_coding KNOWN, 688 bp
ACGCGCTTTTACCGGCCTCTCGCGAGAGTACGGCCTCTTC
CCAGGCCGTCGTTGAAAGAGACACAGGCCATGTTCAGTAC
CAGCGCGAAAATAGTGAAGCCGAATGGCGAAAAGCCAGAT
GAGTTTGAGTCTGGCATTTCCCAGGCTCTTCTTGAGCTGG
AGATGAACTCTGATTTGAAGGCTCAGCTGAGGGAGCTCCA
CATCACTGCTGCTAAGGAAATCGAGGTTGGTGGTAGCAGG
AAAGCCATCATCATCTTTGTGCCTGTGCCCCAGCTGAAAT
CTTTCCAGAAGATCCAGGTGAGGCTTGTGCGTGAGCTGGA
GAAGAAATTCAGTGGCAAGCACGTGGTGTTCATTGCACAG
AGAAGAATCCTGCCTAAACCCACAAGGAAAAGCCGCACAA
AAAACAAGCAGAAGCGTCCCAGGAGCCGAACTCTGACTAA
TGTGCATGACGCTATCCTTGAGGACCTGGTCTTTCCCAGC
GAGATTGTTGGTAAAAGGATTCGCGTGAAACTGGACAGCA
GCAGGCTCATCAAGGTCCACCTTGACAAGGCACAGCAAAA
CAACGTTGAACACAAAGTTGAGACATTCGCTGGTGTCTAC
AAGAAGCTCACAGGAAAGGATGTGATATTTGAATTCCCAG
AGTTTCAACTGTAAAGTGCAGATGACAAAATAAATTTGTT
TACTGTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rps7-201 Contained in:
OTHER rps7-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006213 (1)
  • Ensembl_Trans:ENSDART00000126229 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CF595273 (1) 932bp
    GenBank:CK238111 (1) 825bp
    GenBank:AY561508 (1) 691bp
    GenBank:BC059562 (1) 654bp
    GenBank:AL714657 (1) 646bp
    GenBank:BM859998 (1) 645bp
    GenBank:BM183451 (1) 644bp
    GenBank:BI427834 (1) 625bp
    GenBank:BQ093813 (1) 617bp
    GenBank:BQ615463 (1) 610bp
    GenBank:BE016474 (1) 609bp
    GenBank:AW281110 (1) 605bp
    GenBank:AL912598 (1) 604bp
    GenBank:BG305202 (1) 600bp
    GenBank:BQ132389 (1) 597bp
    GenBank:BQ132265 (1) 596bp
    GenBank:BQ420083 (1) 596bp
    GenBank:BI427771 (1) 595bp
    GenBank:BI842913 (1) 593bp
    GenBank:BM860247 (1) 593bp
    GenBank:BQ092465 (1) 587bp
    GenBank:BE557771 (1) 580bp
    GenBank:BE017061 (1) 576bp
    GenBank:BI706899 (1) 573bp
    GenBank:BQ092220 (1) 569bp
    GenBank:CB357810 (1) 568bp
    GenBank:AI397132 (1) 567bp
    GenBank:BI704923 (1) 567bp
    GenBank:BM186897 (1) 559bp
    GenBank:AW232734 (1) 558bp
    GenBank:BI880220 (1) 558bp
    GenBank:BM534057 (1) 551bp
    GenBank:BQ078193 (1) 551bp
    GenBank:BG308933 (1) 550bp
    GenBank:BG884302 (1) 528bp
    GenBank:BE017374 (1) 513bp
    GenBank:BE016872 (1) 483bp
    GenBank:BE605481 (1) 458bp
    GenBank:CB362773 (1) 353bp
    GenBank:AI106130 (1) 318bp
    CITATIONS (2)