Transcript

slc17a7a-201

ID
ZDB-TSCRIPT-090929-6627
Name
slc17a7a-201
Previous Names
  • slc17a7-001
  • slc17a7a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023605 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023605|OTTDARG00000019270|ZDB-GENE-050105-5 slc17a7a|OTTDARP00000019602 DKEY-29B22.3-001 LG_ CR847509.9 Danio rerio protein_coding NOVEL, 1820 bp
ACACCGGTCGGACTCGAAAGTCGCGAGGATGGAGATCCGT
CCGGACCGCTTTAAAGCCCAGGCAGGGAAAACTTTGGGGA
AAATACACAGACTCCTGGAGAAGCGGCAGCAGAATGGAGA
GACGATCGAGCTGTCAGCTGAGGGACGTCCCGAGCTGGTG
GAGGAGAAGGAGCTTCCCATCGTGGACTGCACGTGTTTTG
GTTTGCCTCGCCGCTACATCATCGCCATCCTGTCCGGCCT
GGGCTTCTGCATCTCTTTCGGCATCCGCTGTAACCTGGGT
GTAGCCATCGTCAGCATGGTGAACGACCACACGGTTTACT
CCGGAAAGAAGCCCGTCATAGTGGCCGCTCAGTTCACATG
GGACCCTGAGACGGTGGGTATGATTCACGGCTCATTCTTC
TGGGGTTACATTGTCACGCAAATCCCCGGAGGATTCATCT
GTCAAAAGTTTGCAGCTAACAGGGTGTTTGGCTTTGCTAT
TGTGGCCACGTCCACACTGAATATGCTGATCCCATCGGCA
GCTCGAGTACACTACGGGTGTGTGATCATGGTCAGGGTCT
GCCAGGGACTTGTGGAGGGGGTGTCGTACCCAGCGTGTCA
TGGGATCTGGGCCAAATGGGCTCCACCGCTTGAAAGAAGC
CGACTGGCAACAACAGCATTCTGTGGTTCATATGCGGGAG
CTGTTGTTGCAATGCCTTTGGCTGGAGTCTTAGTGCAGTA
CACTGGGTGGTCTTCGGTGTTTTATGTATATGGAAGTGTT
GGGATCTTCTGGTATCTCTTCTGGATTTTAGTGTCCTATG
AGAGTCCAGCTGCTCACCCGACAATTACACCAGAGGAGAG
GAAGTACATTGAGGACGCCATCGGGGAAAGCGCTGGCCTG
GTCAACCCCCTGCAGAAATTTAAAACCCCCTGGCGGCATT
TCTTTACCTCCATGCCAGTGTATGCCATCATCGTAGCCAA
CTTCTGCAGAAGCTGGACCTTCTACCTGCTCCTCATCAGC
CAGCCCGCTTATTTCGAGGAGGTGTTCGGCTTTGAAATAA
GCAAGGTGGGGATGGTGTCTGCTCTTCCTCATTTAGTGAT
GACCATCATTGTGCCAATCGGAGGACAACTGGCCGATTAC
CTGAGGACACACAATTTAATGACCACAACAAACGTCCGTA
AACTCATGAACTGTGGAGGGTTTGGAATGGAAGCCACACT
TCTCTTGGTTGTTGGTTTCTCTCATACCAAAGGAGTAGCC
ATTTCTTTTCTTGTGCTGGCTGTGGGCTTCAGTGGATTTG
CAATTTCAGGGTTTAATGTGAACCATCTTGACATCGCACC
ACGCTACGCCAGTATCCTGATGGGAATTTCCAATGGAGTG
GGAACTTTGTCAGGAATGGTGTGTCCGCTCATAGTTGGAG
CCATGACCAAACACAAGACACGTGAGGAGTGGCAGTATGT
TTTCCTCATTGCAGCCCTGGTGCATTATGGGGGTGTGATT
TTTTATGGGCTCTTCGCATCAGGTGAGAAGCAGCCATGGG
CGGATGCCGAAAACACCAGTGAGGAGAAGTGTGGCATTCT
GGGAGAGGACGAACTGGCCAATGAAACGGAGGAACTGTAC
AGGACTGGAGGACAGTATGGAGCTATAAACAATCCGCATG
TCGGCGGTCCTAATGGGGGCGGAGCTGGTGCTGGGGCGGG
ATGGGTGTCAGATTGGGATAAAACAGAAGAATATGTTCAA
CCGGTTGGGACAAATAGCTATTTATATGGGGGAGAGGGAG
AAAGAGAGCTCACATAGTGGAAATATATATATATATGAAT
CTAAATTAAGGAGAAGAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations