header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6497
Transcript Name: si:dkeyp-113d7.10-201
Previous Name: si:dkeyp-113d7.10-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023409 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023409|OTTDARG00000019133|ZDB-GENE-061207-80 si:dkeyp-113d7.10|OTTDARP00000019463 DKEYP-113D7.10-001 LG_none CT030199.5,BX323079.7 Danio rerio protein_coding KNOWN, 2121 bp
CCACGACGTGTTTCAGGCGAGAAAGGGGTGACTGTTCGTT
TCTAAGCAGTTGTTCTGGGGGGACTTCTGCATGTTTAACA
CTATTTTGGGAGGTGGGAAGAGGAAGAATGAAAGAGGTCT
TCCAACGGAGCGGTCGTAAACATGAACGGTGCCCTGTACA
TTTCGTTTTTCCAAGGTCAGCTGGAGTCCGCACTGGAGCA
GGTAGTGCAGCTCGCCGTTCAGGAAATCACCAAGACTGTT
GGGGCCACTTTGAATTCAATGCTATTGGAAACGGCCACCA
AAGAGCAGGAAAATCAGCGTTTGAGGGCGACCCTGCAGTC
TCGGGAGCAAGCATACGGCGGTAACGGGAAAAGCAATGCG
GCTAAAGGGAAAACAAACACGAATGATGGAACAAAGCAAC
ACACCCCCAGTCGGAGCCCTGAATGTGGCGTTCAGTCTGA
GACGCTCAGGCGTGAACAGAAAGAGCGAGCAGTTGGTCAG
TTGAAATCCGTCATGGAGCACGTGCTGGAATTCGCAGTTC
GTGAGCTGACCAAAATTGTGGAGGACAGTTTCGACGACCT
GCTCTTGGAGTTCACCAAGAAAGAGCGGGAAAACCACACC
TTGAAAGAACAGCTACAGGACAAGAAAGTAGTGGAGGACA
ATAAGGCTGTTACTGTGGAAACGGAAGATCAGGATAATGA
CTCTGCTTCTCCGAGCAGTTCCAAAGTGGAAAAGCAAGAG
TCGAAAAGCCTCCAGGACCAATCGCCCAAAAAAGAGTGGG
AAAAGGAGCAGACTGAATCCACCAACGAACCAGACAAGCA
AACGGTCATTGCAGTGGCTCAGGACTGGGTGCCTATCCTA
GATAAAGTCTTTGGGCAGAAGTGGTGCAGTGACCTCTGGC
AAATCAAAGAGGTCACCACTAGTAAGGAGCAGCACACCGG
CCTGAGCTCGGGCCCCATGACTGACATGGACAGTCTTATT
CGGGAGACGCTCATGCCATCTTGCCTGGCCACTCAAAGGA
GGCTGGAGCTTGAGGTGGGGCAGCCGCCTTGGTTGCAGGC
AGACGATATGGAGGTTCTGTCTTTATCCTCTGAAGCCCAA
GGCGTTCCTGTCGTCAGCTCCACAGGTGATGACTCTCAAA
TCAGATCCCCTTCAATGTTGCAAAGACTCCTGACACTCCC
TTCCCAGTTGCTTGAGGATGACGATGAGTCAATGGATGCT
GCTCCAAGTGTAGAAGCGTCCACGGAACCAGCCGATTCAC
AAAGCAGCAAAGGCCCAAAGAGTAACCAGAAGAGAAAGGA
AGAAGAGAATGAAGATGAGGAGGACGACGAAGATGACGAC
GAGGCCACGAACAGATGCGAGTCCTCGAAACACAAAGGTA
GGAGGAAATCCCATGCTTGCAAAGAGTGCGGGCGAAAGTT
CAGTCGAGCACATCTTCTCAGAGCTCACCGGCAAACACAT
GAGGAGACGCCTAACCAGTGCCCACAATGCGGAAAGAGCT
TCTCCCAGTCATCGAGACTCCAGGCTCACTTACGAACGCA
CACGGACAAAATCATGTAATCGGGGAATTTAGGAAATGAA
TTGAAAAAGGGAATGTTTGTTGTAATTTGGTCGAGACGGT
AAATTTCATTTCAAGTTCTGCTAAAGAAAATGCAAAGCTT
GTAGCCTTTTTTTGTTAGTTTGAAGGTACTCTGAGGATCT
TCAGATGCTTTTTACCTTCATTTCAGTTCCCTAATTTTAG
GGATTCAAATATCAACTGAAGAAACAACAAATGTCAGTAA
CGACAAGCTGTGTACGCATTGTAAATATCAAAGTAGGGCT
GTACAGATCATCAGAATAAGAATCGAAGACTTTTTTTCAT
TAAGTGTGATTTTTCTTTTTCGTAACACAAGGTTTCAAAG
ACCTGTGTAAATATTTCAAACATAATATGAAGCTGTTGTG
TAACAGAAGAGGAGCGCAGTTGTTACGTCTCTTGTAGCAT
GCTGGTGTTGTTTTTTCGTTTAACAAAGTTTTGAATGTGA
TCGAACAAACCAGAGTTAGTGTAACGCGTCTCCTGCGATC
AAATCGACCATCTTTTTTGACTTTGAACTCAACATGAAAT
ACCTCTTACGTTTTGATGTCATACTGGATTTTTTGGATAT
T

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkeyp-113d7.10-201 Contained in:
OTHER si:dkeyp-113d7.10-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023409 (1)
  • Ensembl_Trans:ENSDART00000141237 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT664146 (1) 757bp
    GenBank:CT603450 (1) 710bp
    GenBank:CB354647 (1) 560bp
    GenBank:BI886824 (1) 538bp
    GenBank:EB917627 (1) 350bp
    GenBank:EB830395 (1) 266bp
    CITATIONS (2)