header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6352
Transcript Name: cyr61l1-201
Previous Names: cyr61l1-001, zgc:112060-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023178 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023178|OTTDARG00000018962|ZDB-GENE-050417-136 cyr61l1|OTTDARP00000019295 DKEY-2N12.4-001 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 1855 bp
TGTCTATAAAACTGGCAGTCACTGAGGGAATCCAGCAGCA
CACAGCTTTGCAGTTTTTTGCATTTAGCCATTCATAACCT
AAAGAGAAAAACTCGAGTGTAATTTGCTGAAGCCCTTGTG
AATTGACAGATCCAGAACCAGGTCTAAACCAGAAGACACT
TTCTGACGGCCTCTTAACAATTTTTTGGATAACACCATGT
CTCCTCTGAGGATCATATTAAGGCAAGGACATTTCTTCAC
ACTGGTGCTGCTGTCATGGGCCACTGCAGAGGTGCAGGGA
GGATGTCCGCTGAAATGTTCTTGTCCTTCCACTCCCCCCT
CGTGTCCTCCAGGTATCAGCTCGGTTTTGGACCACTGTGG
CTGCTGTCGGGTCTGTGCCAGACAGTTTAACCAGGACTGC
AGCCCTACTGAACCCTGCGACCACATTAAAGGACTGCGCT
GCCACCTAGGGGCCGAGGGAGACCCTGATAGAGGCTTATG
CAGAGCGGAGGCTCAGGGTCGCCCGTGTGAACTGGATGGA
CGGATTTACCAGCACGGAGAGGACTTTCAGCCTTCCTGCG
AGCATCAGTGCACGTGTGTGGATGGGGTGGTCGGCTGTCT
GCCATTGTGCCCACACCACATCTCTCTGCCCGACTGGCGC
TGTGCCCGCCGCCGTCTCATCAGAAAGCCTGAGCGCTGCT
GTCCGGAGTGGGTCTGTGATGACGACAACCGCATTGCTGA
GGTGAATCCAGTGCCCGAAGCTCATCCAGCAGAACACACT
CACCTCACGGGCAATGAGCTACTGGTAACTCCATCTGCTT
CCTGGGACAGCAGTGCAGGAGCCCCTTATCAAGAGTGGAT
TTCATCCTCTAAGTCCCGCCCTATCGCTCCAGCCACCTGC
TTGCTGCAGATCACCGATTGGTCGCCATGCTCTGCCACCT
GTGGAATAGGCGTGTCAAGCCGTGTAACCAATAGCAACCC
AGAGTGTCGGCTAGTAAGCGAAACCAGACTCTGTCAGATC
CGAGAGTGTGGCGTCAACACTGCACCATCAATGAAGAAAG
GAAAGAAGTGTGAAAGAAGCACACGGCCACAGAAACCTGT
GCAGATCAGTTTTGCTGGATGTTCCACTACTCGCCGCTAC
CGGCTGCGTTCATGCGGATTCTGCTCAGACGGTCGTCTGT
GTGTCCCATCTGCAACTCGGACAGTCCGTCTGCATTTCCA
CTGTCCAGAGGCAGAACGGCATGACTTCACCCGCAGCCTC
ATGTGGATCCAGCGCTGCAGCTGCAGACACACACACAGCA
GACGAGGCCTGAACACACCAGCTGAACTCTTCAATTTGCC
CAATGACATACACACATACACACACTGACAGCAACAGATC
CACACTGCCCTCACTCTACAAAACATTTAAACCCAGCATA
CATCAATACAACAGATGCAATATAGGAATACTCTGAATAT
AATGTTTTAAATATTACCGTTTTATTATGTATGTGGTAAT
GACACAGGTGGAAGAAAGAGGTTTATTTTAACTGTAAGTA
AGAGGTTTATTATGATATTTTATTACGGTATGACTGCAAA
GCTCATTTGTTTTATATAATTTACACACACACATAAATCT
TTTATTAATATTTTCCCCTTCTGTTGTAGTTGAATCCAGA
TTTAATGTATATAGTGTACATTTGTACAAATATCGCTGTA
AATATTTATGATGTGAGTTTGTTTTTATTTTATAATATTT
TATGGACTTCTTCAGTTCTTGTGAAGAGTCATATTCAAAC
CTCAATTTTTTGAGGTGAATAACAAGCAGGCCGCTTGTTT
GTGCATATTTACATTAATTTTGTCAAATAAAAATGAGCTA
CAATTTCCATAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyr61l1-201 Contained in:
OTHER cyr61l1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023178 (1)
  • Ensembl_Trans:ENSDART00000051336 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC093177 (1) 1868bp
    GenBank:CO934773 (1) 837bp
    GenBank:CO935836 (1) 781bp
    CITATIONS (2)