ZFIN ID: ZDB-TSCRIPT-090929-6345
Transcript Name: cplx4a-001
Previous Name: si:ch211-233a1.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023153 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023153|OTTDARG00000018944|ZDB-GENE-060526-116 cplx4a|OTTDARP00000019273 CH211-233A1.5-001 LG_ BX248399.5 Danio rerio protein_coding NOVEL, 2514 bp
TATAGAGTTTTCCACTTTCTCTCAGGTTGTTCTGTGTCGC
TGATATTTTAGTTGCAACTCCTGATGGATAAATGCATGGA
GGTCTTTCACTTTTACAGTGCAGCAAAGCACACAGCCATC
TGCCTCTGTGTAGACGGACGCATCTTAATCCAGATTATGG
CTGCAGCATAAACGTTTTTTTTTTTTTTTCCCCCCTAGTC
AACAGTGTGTCCTTGATAGCACAGGCAGGTCGGTTAGCCT
AGCTCCAATTTGACCACCAGCAATCAATCTAAAGGACTTC
TATAGTGGAAATCGAGGATTCAGACCCAAATATTTCAGGA
AATCGCAACTTGGCATCAAGCTAGAGACTCCGGCGTGGTA
AATAATGGCGTTTTTAATCAAAAGTATGGTGGGGAACCCA
TTGAAAGGAATGGGACTTGGAGGAGGAGATGAAAAGGCTG
AAGAGGAGACCCCTAAAGACCCTGCTGCCGCCGCCGGGAT
GACTCGAGAAGAATATGAGGAGTACCAGAAACAGCTTGTG
GAGGAGAAAATGGAAAGAGATGCAGATTTCTTGCACAAGA
AAGCAGAGAGGGCGACTCTGAGGGTCTGTCTAAGAGAAAA
ATACAGACTTCCCAAAAGCGAGCAGGACGAGAACATGCTG
CAGATGGCCGGAGACGATGTGGACGTTCCTGAAGAGCTAC
TGAAGATGGTGGATGAGGATGCCACAGAAGAAGAGGAGAA
GGACTCCATCATGGGCCAGATTCAGAATCTACAAAACATG
GACATGGATCAGATCAAAGAGAAAGCCAGCGCTACGTTGA
CAGAGATGAAGTCCAAGGCCGAGGAGAAATGTTCTGTCAT
GTAGGGGTTTAACAAACTTGCGCATTTCTACACACAACAT
TAACAACAACAAAAAAGGTCAGGATTTTGATTTGGAGGAG
ATTTGAGGAGAAAAAAAATGTGCACTGCAAAACAAAAAAA
GGCTTTTCTTACCTGAAGTTTTTGTCTTGTTACTATATAG
TGCAAATATCTAAAATTAAGAAGCATTTTTAGACAAGTAA
TGTTTTCAGAAACAATGTCAAATTCTTATCCCGAGTTCAG
ACTGCATGATTTTAGCCCCTAATTTTGACTTGCCAAGAGT
TTTTGAGAAATCGCAGACAAATGACTGAAATCACAAGCAA
ATCGGTGCTCTTTCACGTAAGTAACAATCACACAGTGTGA
ACTATCAAAGATCTGAGAGAATCGCTGATGAGTTGCACAA
CGCCCGTGAGATATTTGGCATGCTAAACATCTGGAGCTGT
CGGCTATTCAAATCATGCTGTGTGAAATGTGTTCTGATTG
AAAAATAACATCCACGATCACCTACAGCCAATGAGAGAGC
AGCATCCACTAGTAAGAATATCTGCAGGCCAACGGGAGGA
TGGGGGAGAAGTTAAAAATGCTTCTTTTCGGTCTATTTGG
ACGCAAGAAATGGAGGAAAAACTAGTAGAAATTTGGCAGA
GGCACCCATGCCTGTTTGATGTGTTATCTGAGCTATATCA
CAACCGGGTCAAGAAAAAAAAAAGTTGTGGAGAAATTGCT
AATTCCCTTCAATAGCCAGGTGAGGCTGAGCACAACAAGT
ACAACAGTTTCTACCTCACTAAAGGCTTCTTTCTCATTGT
GTAATTATTAACAAAGTATATACTACGCGACCTCACATTG
TTTCCATGTCACTTCTCACTTGTGTTTGATTGTAAGACGT
AGTTTGTTGGTCGATTCTACCTGTTGTAAAGCCATGCAGT
GTGAAACCTGTCACCGATCCATCCTACAGTGTAAACACAG
CAGCGAACGAATGCTACCCCAGATTGTCATGCAGTGTGAA
AACATCTGTGACGCAACTACTTTGAAAATCGTGCTGTCTG
AACTCAGCGTTAGGGTTTTTGTCTTCTTTCTAGTACAAAT
ATCTAAAAATTCTTAAGCATTTTTTAGATAATGTTTTCAG
AAACAATGTCAAATTCTGCTAAAAAAATGCAGAAGCATAT
ATTGAGAAGCATTTTTAGACAAGCAACACTTTAAAAAATA
TGTTTGCTAATTGTTCAAACTAATTTATGAGTTGAATAAA
TGATTTTTGGGGGCGTTTTTGAGAACTAGATTGTTTAATG
TTTAATCAACTTAAATTTGTAAAAACAGTTGAGTTAACTC
GACTAACTTAATCGATTTGAGTTGGGACAACATGAAGGAA
TTGTGTGGAACCCATCATTTTTTTACATTGATGTTTTTAG
AAACAATGTCGAATTGAAGTGTGTTTTTCCTGAAAACAAT
CAAAAACAAAAGTAAAAAGAATTAGTTTTAGTTTAAAAAG
TTTACTTTGCTTAAACTCACTTTTTAGCTTGTTTTAAGAA
AAAACACATTTAATTTTGACTTCTTATTTCTAAAAACAAT
GCAATAATATTACTTCAAATCAAATCACTTTTATTGTAAT
GTAATGTGTGCTATGATGAGTGAAAAGTTTAGGTGAAAAG
CTTGTCTACACTAAAAAAATAAAATAAAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cplx4a-001 Contained in:
OTHER cplx4a-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023153 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC124673 (1) 2321bp
    GenBank:EH440464 (1) 921bp
    GenBank:CV485907 (1) 886bp
    GenBank:DT872420 (1) 833bp
    GenBank:DT864566 (1) 803bp
    GenBank:DT870674 (1) 793bp
    CITATIONS (1)