header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6342
Transcript Name: si:dkey-277m11.2-201
Previous Name: si:dkey-277m11.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023150 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023150|OTTDARG00000018941|ZDB-GENE-060526-285 si:dkey-277m11.2|OTTDARP00000019270 DKEY-277M11.2-001 LG_ CR925730.6 Danio rerio protein_coding NOVEL, 883 bp
TCCAAACTCACCCACATCAAACAGCTCTGGATTCAGAGAA
TGAGCCCAAACACTGCCGCAATCTAATCCAGGCCATAACT
TCAACACAAACCGTGATGAAAAAACATGAAGATCTGGCAT
ATTTACTGAACTTGGTCTGTGTTTGATGTGAAGTTGAAAA
CGCCACAAACGTCAGCTTGAAGAGGCCATCTGCACGGTTC
CCGTCATCTTGCACTCCTCTGAGCGACACGTAAACAGAAG
ACCAGAATCGATAACACTTGCACATGACAGCTGTGTGAAC
CTGCGGCTGGAACAGACAAGAGCGGAAAAATCAAGTCACA
GTTTATAGGTTCATTCTGAGTTCAGTGAAAAAACGACATG
TAATATATAAAATGTACAGCATCTATTTTCATTCTAATAG
TACCAACTTTTTCAGATAATAGTATTCTTCCATTAAGTAT
TAGTAGTTGAATTAGTACATCGAATCCTAGATCTCATTCT
TAAGATATTAGTATATATATTTTTTAAATGCAAGCATTTA
TTTACTAGATATTAGCCTAGTTTTTCTTATAAGAGGGGCC
AGACAGAATCTGCTGACTTTTTTTTTTTTTGCTCTTTCTG
CGGAAGATTTTGTAAAAAATCTGCGGATTTATGCGAAATT
ATTATCTATGAAATAAAATAGCTTTAAAATTTTATTTAAT
GTTTACAATGCAAATCCATCTAGCTCCACTTATTCAGTAC
ACAAAGCAAGTCTATCATTTAATAAATATATACTAAAATA
CAAAAAATATTACTTTACAAACTGTATTGTAAATAAATCA
AATTAACACTTTTATTCATTCATTCATTCATTTTCTTTTC
GGCTTAGTCCCTTTATTAATCTGGGGTCGCCATAGCGGAA
TGA

si:dkey-277m11.2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-277m11.2-002 (1) 439
mRNA si:dkey-277m11.2-201 883
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-277m11.2-201 Contained in:

OTHER si:dkey-277m11.2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023150 (1)
  • Ensembl_Trans:ENSDART00000134408 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK017394 (1) 902 bp
    CITATIONS (2)