ZFIN ID: ZDB-TSCRIPT-090929-6340
Transcript Name: si:ch211-233a1.4-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023148 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023148|OTTDARG00000018939|ZDB-GENE-060526-115 si:ch211-233a1.4|no_translation CH211-233A1.4-001 LG_ BX248399.5 Danio rerio processed_transcript PUTATIVE, 530 bp
CGCATTGAGGAATGAGGTCAATACATTTCCCACAATAAAA
GACATGGTTAATTTTCAGAAGGGGGAAATCAAGACCATCT
GAAGACCAGCTAAAACATCTGAAGGACACAAATACCAAAA
TCAACAGAAATCTAGATGTTTGCCGAACATGGTGGTGAAA
TCATACTGTGCTGGCTGTAACATAAAATGTGGAAAAAGTG
AAGCACTATGAATACTTTCTGGATGCACCTCATCTCCATC
TGTGGAACAGATAAACAGCTATCATTTCCCCATTGCTAAA
ATGGTTGGAGCAAACATCATTTAGGAGTAGTTGGAGCAGC
AGAGGCGAATCCATCATGTCCTGGAGTACTGCAGTATTAC
CAAAACAAGACCATCCTGAAGCTTTTGAATGTGGTTAATA
TATTGTAGATTGTGGAGACTAAAAGAAACCGGTTGGACAG
CCTCTACAGCACACATTCTGCTCCATCAACACTTTGGTCT
GTTTCTATTATTTTTCATTATACAAAAGTGTCTGGAACTT
AAAACTTAAT

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-233a1.4-001 Contained in:
OTHER si:ch211-233a1.4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023148 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR930762 (1) 539bp
    CITATIONS (1)