header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6339
Transcript Name: grp-201
Previous Names: grp-001, si:ch211-233a1.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023147 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023147|OTTDARG00000018938|ZDB-GENE-060526-117 grp|OTTDARP00000019268 CH211-233A1.7-001 LG_ BX248399.5 Danio rerio protein_coding NOVEL, 753 bp
ATGAGCGTTACTATGTGCCTGGTGTGGAGATACAGATTCG
TCGTGTCCATCATTTTGGTCGTTGTGCTCTGTGAAGTGTT
TGCATCAGACGCACAACCAATCGGAAAAGTTTATCCACGC
GGGAATCACTGGGCTGTTGGACACTTAATGGGCAAAAAAA
GCACAGATGACCAGGACATATCAGAAGATTCAAACGACGA
TGCTGTGACCTCTGTGAGCCCGGATCAGGATCTGCAGCTG
GAGAGATACAGCAAACATCTGCCTCTCCGGCTGTATGCGC
TCATGAATGAACGAATGACACAGGAGAACCCGCAGGACAA
CACAGAGGTCAACGCTTTAAAACTGATGCAGCGCATGATC
GAAAAGGGACGCCAGTGGGAGGAAGAGAGAGATGACAGAG
CTGAGAAAGTGGCTGAGGACTTGTTACGGGCTTTAAGAAT
GCAGTACGAGGACGAAAGCTGAGGACAAACTGGCTAAAAG
ACTGTGATTTGAAGCTGAACAACTGGCTCCATCAGATACA
AACCTCTTTAGTCAACAACATATCAATAAGCATGTTATAT
TTTTCTATGTCGATATATGAAATACACATAACCCGAGTGT
CTTCATTCTGTACATTTTCAGCTGTTGTTTTATAAACTCA
TCTTACTGGCAGCCATTGTAGTCATGATACAATTGTATGA
TAATATTTAATAAACTTGAACTTGTTGGGCTTTCTGCGGT
TTATAAAAAATGACTGTTTTGCATATCATTTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grp-201 Contained in:

OTHER grp-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023147 (1)
  • Ensembl_Trans:ENSDART00000063244 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES No data available
    CITATIONS (2)