Transcript

kiss1rb-201

ID
ZDB-TSCRIPT-090929-6332
Name
kiss1rb-201
Previous Names
  • kiss1rb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023130 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023130|OTTDARG00000018925|ZDB-GENE-060526-54 kiss1rb|OTTDARP00000019256 kiss1rb-001 LG_ BX510999.12 Danio rerio protein_coding NOVEL, 1095 bp
ATGGCAGAAACTAACAGCACCGGCGATGCTGCAGAGCACA
TCATGTGCAATTATGACGCAAATATTTATCAGTGCAATCA
GACGGATCTGATGAGATTCCAAAACCCTGTTCCTCTGACC
GACACGTGGCTCGTCCCGCTGTTTTTCACACTCATCATGT
TTGTGGGTTTAGTGGGTAACCTAATAGTCATCTATGTGGT
CATTAAAAACCAGCAGATGAAGACGGTTACAAACCTCTAC
ATAGTTAATCTTGCCACCACCGATATACTTTTCCTGGTTT
GTTGCGTTCCCTTCACTGCCACTGTGTACGTTCTTCCTAG
CTGGATATTTGGGGATTTTATGTGTCGCCTGGTCAATTAT
CTGCAACAGGTAACGGCTCAGGCGACCTGCATCACTCTGT
CCGCGATGAGCGTGGACCGGTTTTACGTGACTGTGTACCC
GCTGCAGTCTCTCCATCACCGAACTCCACAGATGGCTCTG
TCCGTGTGCACCACCATCTGGATATGTTCTTCACTGCTCT
CAGTGCCGATTGCTCTGTATCAGCACACTGAGTCTTCATA
CTGGTTCGGCCCACAGACGTACTGCACTGAGACCTTTCCT
TCGGTCATTCATAAGAGAGTTTACCTCCTTTACTCCTTCT
TGGCTGTTTACCTGCTGCCTCTGATCACCATCTGCATGTG
TTATACCTTCATGCTGAAGCGCATGGCGCAGGCCACAGTC
CAACCAGTTCAAGGCTGTAACCAGATTAGTCTGCAGACGT
CATCGGAGCGTGCTGAAGCCGTGCGCAGCCGCGTCTCCAG
GATGGTAGTGGTGATGGTGCTGCTGTTCCTGCTGTGCTGG
GGTCCCATCCAGATCCTGATCCTGCTGCAGGCCTTCTGTG
CTGAAGACGTGAGCCGCAGCTACACGCTCTACAAGCTGAA
GATCTGGGCGCACGGCATGTCCTACTCCAACTCCTCCATC
AACCCCGTCATCTACGCCTTCATGGGGGCCAACTTCAGAA
AGGCCTTCAGAAGTGTGTGTCCTCTGATCTTCAAAAGGAG
GAGCACCGAGCCGCTCGCCACATATAACAGAGAGATGAAC
TTTCTTTCATCCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations