ZFIN ID: ZDB-TSCRIPT-090929-622
Transcript Name: apobb.1-201
Previous Names: apobb-001, apobb.1-001, apobl-001, si:ch211-219i10.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006082 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006082|OTTDARG00000005612|ZDB-GENE-030131-9732 apobb.1|OTTDARP00000005429 apobb-001 LG_ BX511210.5 Danio rerio protein_coding KNOWN, 11495 bp
ATGGGGGGGACTAAGCTCTGCCTTTTGCTACTTCTATGTG
CAATTGCCTTGTCATTGGCCAAAAGGTTCAAGAGCTTTCA
GAAGTATGAATACACCTACGAAACGGAGTCTCTAAATGCC
CTGAATGGAGCAATCAATGGTCCCAAGGCCAGATGCAAGG
TTGAAATTGAGGTCCCACGCATATGCAGCTATATCGTTCA
CACAACTGAGTGTGAGTTGAGTGATGTCATCGATGTTGAT
GCTGAAGGAAAGCCTATCTTTATGTCATCTGCTGGTGCAG
AGGCTTTCAAGGCTGCCATGGCAAAGAACCCCCTGAAGTT
CACCGTTGAGGGAGATAATGACATCAAGTTGTTTCCTGAG
AATGATGAACCAGCCAACATTTTGAACTTCAAAAGAGGTC
TAATCTCAGCCCTTGCAGCACCTGTGCTGGAGGAAGACAG
AAACAGGAGAATGCCCACCGTCTACGGCATGTGCAGGACA
GACTACTCTGTGAATGCCAGACAGGATATTGCCACCGATG
TTGTCCTCAACAGAGACTTGTCTAACTGTGACAAATTCAG
CCCAGTCAAAGACCACACTAGTCCCCTGGCACTTATCACA
GGAATGCAATACCCACTTGCTCAGCTCATCAGAAGCAGCC
AAACCTGCAACTACAAGTTTGACAATGATCAAAAGCATAT
GACCTCGGCTTCTTGCTCTGAAAAACACATGCTTTTGCCA
TTTTCTTACAAAGGAGAGCATGGCGTTTCTAATGTAGGAA
AGCAAGCTTTGACTCTGGTGGGAGTGTCTGTATACAACGG
CAGAATCTTTGACCACAATGAAGCCAACATGAAGACCCTG
CATCTTGATGACAGCATTGACTCAGTCCATCCAATTCAAG
ACAAAGATGCAATCCTGTCAATTCTAAGGGACCTGAATGA
CCTTTCTGAGACCACAAATGGAGAAAATAGAGCCCATCTT
GCTCACAAACTCATTTCTACCATCCGCAAAATGAGTGCAG
AAAGCCTGAGTGCTGCTCTGCCAGAGGCACTGGAGATTTC
TCGCCCCCTTGTGTACCAAGCTTTGTTCCAGTGTGGCACT
CCTGAATGCACCAGTGCCATCCTGCGGGTTCTCAGAACCT
TTGACCGTTCCTCTGTAGAGATTGATGCTGCAGTGTATGC
CATGGGAATGGTTCCAAATCCATCCAGAGACCTTGTTGAG
GAGATGCTGGAGATGGCCAAGTTCAAATCTAGCAAGCCCA
TCTACTATGCTCTCAGCAATGCTGTGAAGAGGCTCTATGA
AGTTGAAAAAAGTGTCACCCCTGAGATCAAGGCAGTCGCA
GATTACACCCTTGAACAGATTGGCGACTGCACAGGGAACC
AAGAACATGTGTACCTGTCCCTGAGGGTCATTGGAAACAT
GGCTGCTGCTGTCGGAGCTGCAAGCCCTGCTCTGAAATCA
GCAGTTATCCAGTGCATAAACCAACCCGCTGCATCCCCTG
AGGTCCAGCAAGCTGCTATTCAAGTATTTAGGCTAACTTC
TGTTCCTGACGAGGGCAGAGAGGTGCTAATGAAGGTCATT
TTCGACAAAGCTGCTCCAATACAGAAGCGTGTTGCTGCGT
ATCTCATTGTGATGAAGGACCCTCAGCCCACTGAACTGGC
TCAGCTGGTTGCAGCTCTGCCTAATAATAAAAACTGCCAG
GCTATGAGCTTTGTTAACTCACATCTCCGGAACATCCTGA
GCTCTACAACATCAGAGACCGGGGAACTCAGAGTAAAGAT
TCTTAATGCCCTGCAAGGAAATGAGATCAGTACTTCCACC
GATCCAACAAAATTCTCTCGCAATTACAAGATTGGCTCTC
TAGAGGGAAATGTGATTTTTGAGTCTGAAGAACTTCTGCC
CAATGAAGTCATCCTGGAGATGACCCTAAATGCCTTTGGA
TATGATGTTGACATGTTTGAGATTGGGTTAAACGGAAAGG
GTCTGGAACCCACTGTTGATGCCCTGATTGGTATTGATGG
ATTCTTCCGTGACACCATGCAGAAGACCATTAACTATGCA
GCTGACAAAGTACCAAGGGGCAATGACATTATGCAGAGCA
TGTTCCCAACCCTATGGAATAACATCAAAATGCAAAAGGC
CCCTCAAAGCATTGTCAAAGAAATAACAAATAATGTTAAC
AAGCTCATCCAGAAGCTGAAGGTTCAGGACAACCCAGAGG
CTATGATCTACCTGAGGCTTTTGGGTGCTGAAATGGGCTA
TCTCAAAACTAATGATGTAGAAGACATGGCCTACTCTGCT
GCCTTGCTGACTAAAAGCCTCCTAAATATGTTCCCTACTG
ATTTCCTAAGGAACCTATACTCAAGTGTCAACAACAACCT
TTTCCTTCACTACGTCTTCATGGACAATGAGTTTTATCTA
CCAACTGGTACCGGCATTCCTCTAAGAGTTGCCCTGTCTG
GTACTTTTGCTCCTGGAGTGAAGGGAGGACTGAAACTTGC
TCGTGACATGAGCGAAGTGGCTTTCATGCCATCCGCTGGA
GTTGAGTTTGTGACGGAGGTTGGAGCTCTCCTACCTGAAT
ATGTTGAGTCTGGCCTGGAGATGCATACTAACATCTACCA
CGAGAGTGGTCTCAAAGTAAAAGTTGCAGTGACCAATAAG
CAGTTCAAGTTGACCATTCCCACACCAAAAACTTCAACAA
AACTCATCAGTGTCTCAAACTCATTGTATTCAGTGACTGG
TACAGAAATCAAGAGGATTCCTCCACTGGCAGAGCATGTG
AAAGCAAGGAAGTGCACTCCTTTCATTCCTGGTTTTCAGT
ACTGCGGTGTCATGCAATATTCTAATGCCTTTTCCAACGA
TGCCGCTCCCTACTTCCCTTTGACTGGTGATAGCAAATTT
GCCATTGAGATCCACCCGACTGGTGAGGTTTCTTCATACA
CAGCAACTGCTGATTATGCATATGATGGCAAAGATGACAC
AGTGACATTTGGTCTGAAGGCAGAAGGAATAACATTTGAG
AGCATAGTCAAACTAACATTCGACAGACAGAATTATGAAG
TCTCGGCTGACGTCCAAATTCCTGACTATGACCTGGAAGC
TGGAATTCGGGTTCATGCTGTTGATCGAAAAGCTCAGAGT
GATGCCACACATTCCATCCAGATTGACTTGATGAAGAAGA
ATGTACCTGAAGCATCTCTCATTGGTCTTGCTAAGATTGG
GTCAATGAAGGATGCCATGCTGCAGGTTCAGCTGCTCATT
CCAAATTTTGAGACTGATGCTAAAGTAACGGCAACACTAA
AAAATACTGATGAACTTAAAGTGGAACTTGAAAGTGACAT
AAAGCTTCCTGAGATGACCTCCTCTATTCAGAAAATGATT
CTGAAATATGATGCTGAGGAAATTGAGGCTGAGGTCTCTT
CTGATGTCACCACTGAGATTCACAACATTATAACTACTGA
TGCCATCAAAGCCACATTCAATGATATTCTTGACCAAGAA
ATTGGCACATCTGATAAGAAGATCCGTGATGTCTTGACCC
AATTTGTTGAGGCTTCAAATGCCTACCTGGAGCAATTTTC
TCCCAACATTCCATATGTACAGGAATTGAGGATTCCTGCT
CTCCCAGAATTCACTTTCCCTAAGAAGCTGTTCCTGAATG
CTGAGGGTGCTGCTAAATACAAGTTTGGCCAGAATTATTA
CACCATAACCATACCTGTTCCTCTTGGTGGAAAAACTTCA
AGAGATTTCAACCTCCCTGCTGCTCTGGAAACACCAGTAC
TGAACGTACCACAGCTTGACCTTCAGGTTAAATCCATTAA
TATCCCACTTCCAGTGTTCTTTATACCAGAGAGTCTGTCT
CTGTCACTACCTCTTGTGGCAAAGGCGGAGGTGTCCAGCA
AGCTGAGCAGCAACTTCTATGACATGGAAGCAAAAGCTTC
TGCAGGGAGTGAACTTGTAGATAAACCAACCTATTCTGCC
ATGATTGAAGTCACAGGAACAAGTCCAGTGGATCTACTCT
CCTTCAAAATAGAAGGATCAACCTTCCTGGTAGGTAGACT
TGGAGAATCTTTGAAGACTGAGATGAAATCCTCCCTTAAT
CACAAGCTCCTTGAAGCCAGTGTCAATTATTTTGAGGAAA
TAACAACTGGAGAAAAAATCACAATGAAATCAAGCAGCAA
GATGGAGGCGAAAAGTCCCTTTGGTCTGAAGATTTCTCTG
GAACACACGGGCCAGGTTGGACTCGATGAAGATGAGATCT
CTGGAGATGGAAATCTGTTGGGCTCTATCAAGGCTGGTCC
TTTGAATGGTGAAGTTGCTCTCAGACAATCACTTATCCTT
CTTCCATTCAAGCCAGAGCTGAAAATCGACTCTTCTCTGA
AAGTAGACTTAGAACAAATCCAAGCAGAGAACATAATTGA
AGCAGCTTTTGCCAATGGAGAGCTCTCTTTCACATCTAAA
TCAACAGCATTCCAGGACAATCTCATACATGTTGCTGAAC
TTGCCTATAAAGAATCACAGCTTGCTCTGAAGTCAGATGC
AAGGGCAAAGGCTTTCGGCCTAAACATCCAAAATGTAGCT
GAGGCTAGTGCTAGTTTTAATTTAGTTAACGTTAAGATTG
ACACTAATGTTGACACTTTGTTTGGAAATCGTGTCCGTTC
CCAGTTTATAGCAGCACTGGACGCCAATGGGCTGGATGTA
AAAAGTGATGCCTCTGCAAATCTGGATGAACACACAGCTT
CTCACATGTGCAGCCTTTCCCTGACCAGAAACGGCCTAGT
CACAATTGGCTCAACCTTACTAGAGTGCCCAGACATGCCT
TTGACACTGCAGAACAAATTCAATGGAGCCCTTGACACTT
CAGGGCTTTCATTGTCAGTTGAAACAAAAGGTAAATTCGT
TGAAGTGACAATTGAAAACACAAATTCTCTGTCTGCCTCC
CTGTCCTCAGTAGATTTCATTTCCAAAGCTAATAGCGATG
ATGGAACATATGTGCATGACTTCTCCCTTCAGCTTCAGCC
ATATAGTACCTCGTTGAAAATTAGCAATAATCTGAATGCT
CTGAACATCAAACTGATTAATGAGGCACAGTTTAAGGCAC
TTCCATATGCAGCAGATCTGACTGGCAGTTGGAAGCTTTC
CTCTGGAACAGATGAGCTTAAGAACACATATGAGATCAAA
TATGAAGATCTGGTTGCTACAGCCAAGTGTGGTCTCACTG
GAAAACTCATGGGATCTCACATGAGCCAAAACACAGAAAT
TGAAGTTGCTGGACTTTCAGTTACATACGGCAGTGAATCC
AATTTCAACTCACAGTATCTCCGCTTCAATAGCGACTTAC
ATGCCGCTGCTGTTCCCTTCAGATTCAACGTTGATGCAAT
GGTCAATGCAGATGGGGATTTGTATCTGTATGGAAAACAA
AGCGCACAAGTCTACTCTAAATTCCTTATGAAGGCAGAAC
CACTTGCTTTTGCACACTCACATGAATGCAGAGTCTCAAC
AACTTACAACCTGTATGATGATCTGGTATTCGAAACCAAC
CTTGATAATAAAATTGATACTGTGCTGACACCGTCTGAGC
AAAAGGCCACAGTGAGAGTAAAATCTAAGTTCAACAACCA
TGAGTTTAACAAAGACTTGAGTGCTTACAATACCCCTGAA
AGACTTGGAGTTGAAATGTCTGGATCCATCATCACCAACA
TCTTCAATACAGTTGACTCTGACAATCAAGACCACTTTTT
CTCTGCCTTCCTAAAATATGATAAAAACAGCAACAGCCGT
GCCTTAAGTCTGCCATTTATTGATGAGTTTCCATTTGACC
TGCAACACATGAAACTTGCAGTTTTGAGGATTGTTGAGGC
CATGCAGAGTTATATCAACAGAGAAGAAATCATTGTAGAA
ATTCAGAAACTGGCCACATATGTTAGTGACTTTGTGAATG
AACTGAATCTGGAAGAGAAAATCATAAAATTCAGCAAGGA
CCTGACTGCGCTGTATGAGGACTATGGAATTACTCTCGAC
GACCTGGAGGCTTCTCTGATGAATCTAAAGCCTGTTTTGT
TGAAGCTAGTCACTGAACTTGACACTTATGTAGTAGAGAT
AGAAAAGATTGTGAGGGAAATAATTACAAGTGGCACACCA
TCTGATGCTGCAATACAGAGGTTTACAGATATCCTGAATT
CATTCAATGAGAAATATGACGTCAAAGCCATTGTTCTCAC
TGTTATTGAGGCTATTGAAAAATTTCTTAGGGAAATCGAT
GTAATGAGTATAAAGGGCAGCAGGGAAGTCTTCAAGCAAT
ATGTTGATGAATATTTTGCTATTAAATCCAAAGTGGAGGA
AATTTTGAGTGAACTGAAGCAGTTTGTTGCAAACTTTGAC
CAAGAAAAGTTCACTGAGGATGTGAAGAACTTTGTTACCT
CAGCCAGATTCAGAGACTATGCAGACAATCTGGTGGCTAA
AATCCCAACAGAGCAAATCAGCAAGATTCTTGAAAAAGCA
AAACAACTGCTTAATCTACTGGGTAACAGAATGAATGCCA
TCTATACAAATGTGAGAGAAATTCTGGTGAAATCTGGGGT
TGACAAGAAGATCGAAACTCTCCTCAAAAAAGTTGTTGAG
CTTATCAAGAAGTTCAACATTGAAGAAACTGTTAAGACTC
TTGCGGACACTTTGAAATCTATTCTGACCCCTGTCACTGA
GCTGGTGGATAAGGCCATCAACTACTTGAAAACAACAGAG
GCAAAGGAAATCATTGAAGATCTGAACAACTGCCTAAACC
ACTGCATTAAATATATTAGATCATTTGACTACAACGCATT
TGTGGATGAGGCCAATCAGAAAATCAAGAAGTTAACAAAT
GATCTTTACACCATGAGTTTGTCACTTGAAATCCGTCAAA
AGCTTGAGGCAATCAGAGAGTTTGTTAACTATGCTTTGTC
ATCTATGAGCGCTTGCATCGAAAAGCTGGAAAAAGTCAAA
GTTGTGGATGTCGTCAAAAAATTCAGTGACATTGTCGATA
GTGTAGTCTTCATTGACACCGAGGCACTCATTGAGGACCT
TAGGAAAATACTTGCAGACATTGATATCAGAGAAGAAATC
CAGAAGTTTCTGAAGCACGCAAGTAGCATCTCCACCAAGG
TTGTGACCACTGCAACAGATGCATGCAGTGCTGTTATGCA
AGTGATCCAAAACATCCTTAAAGATCAAGCAGTTGTCAAC
GAGCTGAAGCAAATCTGTGACAGAGTCAAAACAGTACTGA
GAACAGCTGAATTTAAGATTCCATCTTTCATTTTTCCACT
GACTGACCTTGTTGTGCCATCCATAAAAATAAGCTTAAAG
AATCTTCAGGAAATCAACCTCCCATCTTCACTGATTGACC
TTCCAGGGTTTACAATTCTGCAATATTACACTGTGCCACC
AATCAGAGTAGAATATGCTGACATCAAGCAGGGACTATTA
GATCTCCTGCACTTCATTGCGAACTTTGAAATAATGCCAG
CTGTCGAGAACATCTTTGGTGACCTTAGAATTGTCTACAT
GCCTGACATCTCTGCCATCACACTGCCAGAGATAAGCTTA
CCAGAGATCTCTCTCCCAGAAATTCCTAAATACATCAGCA
AGCACAAATTTTCTGATCTGACAATCCCAGAATTCACCCT
CCCTGGAGTTCCTACTGAGGTCATGGTGCCATGCTTTGGA
AAGTTGTATGGTGAGGTTAGAGTCACCATTCCAATTTTCA
ACATGAGAACTACAGTAGAATTCCTAAACTCTACTGAAAG
TGCAGAAACCCCTCAGTTTGTAGGGCACATTACCTCACAT
GGATCTTCAGAATATGACCTTCTTAAATACACCTTGGACT
CCACAGCTCGTGTTGCCATGCCTAAAATGAGTCGTGTGAT
TCTTGCAGAAACCCTGAAGATCACTCACAGTGTACTAGCC
ATTGACCATCAATCCTCAGTCTCACTTTATGGCCTCTCAG
CCCAGGCTTCTTCCAAGAGCACCATGAAGATTACCTCTTC
CACCTATAATGCTAACATCGTTAACACTGCTTTCTTTGCC
CTGGCAGGTGGAATATCTGCAAATATCAAAACAACATATA
ATGACAAGTTAAATGCAGACCTTTGGAACAGTGAATATTA
TTACGGTAATGATATAATTCTAAAGCAGGATGGTCTAAAA
CTCCTTCTGACCATGGAAGAAGAGGCCAAGGGACATATAT
CTGTGCTCGAAAAGTCTGATGATATCACTGGCAAGAGTAG
TTCATCTATAATTATTACTCCAACAACATTCTCTCTGATC
ATTTCTGTGGATTCCAGCAGTTCTGTTTCAAACATTAAAA
AAAGTATTAAAGCTGACGGTGTTGCTCTGAGCTATGTCGA
CTTCACTGCCAGCATTGAAGGAACTAGTGATTCTGAGTTA
TTTTTACTGAATGCAGCTGGAAAGGCGGATCTCAGACAAA
TGAAAGTAGAGATGAAGGCTGACCTTGACACAAAATATGC
TGGACTGCTCAGTGGTACCTTCACCAGTGCCTTTAACTTC
TTAGTGCAACCTTTTGAGGTAGTCCTTGATTTCAAGAACA
AGGCTAATACTAAGCTCAACCTTGTAGAGCCCCTGTCTGC
TAAGATTGATCTTCAGAACAATTATACTGTCATCCTTAAT
AGCGACGAGCAGATGTTGAGCACTGGGTTACTTGCCCGCT
TTAACCAGTACAAGTACAGTCACAATTTCACATTGGCCAA
CAACGAGGATGAGGCTGGCATTTATGCTGCAGTAAATGGC
GAGGCTAATTTGGAATTCCTAACAATCCCTTTCAGTATTC
CAGCAATGGAATTAGAAACACTAACTATGGTAATTGAAAT
TCCAGAAATCAGTAACATCAATCTATATGAACAGACTGGG
CTTAAGCATGTTTTGACTGACTTCGACCAGGCCATTGATG
TAGATGCAAAGATGGTTTACCAGAAGAATGACTTAACCTC
TGAGTTGTCTTTCAAGTCCTCCATATTCAATCTTAATGCC
AATGCTGGTTTCTATCAGAAGGATAACCCTGTAATTCGTT
TTGGAGTCATCACTGCTTCTGAGTTTGAGTCACTGAAGGC
CAAGCTTGAAGGAACCAGCAGTCTGAGCACCAAAAGTGGA
TTCAAATTAGCCAATTCTTTGCTTCTAGAAAATCGCCACA
TTGAAGGAACCCATGAAAGCACTGCAACTATGAACCTGAA
TAACTTTGAAGTTACACTGTCTATGGCCACAGATGCAAAA
ATGAATCTACCAATTCTTACAGCTAATGCCAACCACCAAC
TTACTGCTGACAACAAGGCCAACCCAAAAGCAGACTCAAC
ATTTAAGATGGATTACAACTTTGACGTTCCCATTATTAAG
CTTGTTGGAAAGGGAAATGCTGAAACCATCTTAAAAGGCG
AAGGAACTCGTACGTTTATCTCTGCTGAGACACTTATAAA
GAGCAATATTGATGGAACATTCCTAGATCGTGGTATTTTG
AAAGGAACTCTGAATTACGATGAATCCCTGTATGTGAATG
GTAATAGTTTGCGATATGCCCTTAAGACTGGTGGTAATGG
AGACCTGAACTATGGTGATTTCAAGGTGGCTTTTGATGTG
GATGAAAACCTGTCTGTAGAGACAGCCAATGAGCACGTAT
ATGCTACAATGAAGTTTACTTCCAATAATGAAGCAAATGT
TGGATCTTTCAACACTAAAGGAGTTCATTCCAGCCAGGCT
ACTCTCGATATGGCTCTTCTGAAGTCACTGGTGGCTGATA
TGAAAATAGACTTGTCTCAACCGAGCACCTTTGGTGAACT
TAGCATCTTCGAGACAATGAAAGTAGATCTCAGTGCTCCC
AAGCAGAAAATTGATATCCTTTCAACAATCAAGTCTCCGG
TATACACCACAGATGTTCGTGCTAAACTAGACGGTAATGC
CCCAGATTACAAAACGGTTCTGAAGGCTTCAGCCACTTCA
CCAGTTGTGCGCCTGCAGTATGATCTTGACAGCTCCATGA
GTTCTACTATGGAGAATGGTGCCCTTGTTGTCGGAGCTAA
CGCTGTACTTACACATCAGGACTTCACTATGGATATCAGC
AATGCTATTCGCATGAGCGAAAGGAGCCATATTCTGAATG
TGGACATCACCAGCCAAACATTTACCGATGTTAACCTTCG
CTATGCTGCTCGGAGTGATGGGATAAGTGGCTCTGTTTCC
ACACCGGGGTCTGGCCTCCTTGGCTTTCAGCTCCAAGGAA
ATATTCCATCCCAAATGAATGCAAGGCTCTACTGTCGTTA
TGCTTTTGCACCAGATGATGATGTCGACATCCTAAGCGTC
AGAGCCGTACCAAAGGGAGATGAAAAAGTACTGTTGGTCA
CTGGCAATATAAAGGCTGCACAATCCATGTTTGAAGGCTT
AATGAATACTCTAGAAAAAATCTCATTTAAACTTGCAGGA
TTAGCAAGAGAATATGGTCTCGCTTTTCCAATTTTTGTTG
CTGACGATGTTTATGGAGTAATTTCAAATGGACTCTCTGC
TGCCCGCAGAGCTACACCAGGCGTTAGTGAGTTATCCCAA
CTTTTCAGAAATGTAGTTGTCACATCCCAAAAGACCATCC
AGGTCTTGATTGACAATGCCATCGTACTCGTAAAAGAGAT
TTCACAATATAAACTGCCTGGAATGAATGAAGCTACACTG
GCTGAAATTTGCAAGAAAATCCAATTAGTTGTTGTAGAAA
TGCTGAGGAATTTTGGTAACAACTTAGAGGTATACTTCTC
TCCCATCATGGATAACTTTAATACAATTCAATTGACATTT
CCCAATGGAAAGGTCATGACAGTAGCTGAGTTCCAACAAA
ATGTGCAAAGTATCCTGAGAAGCAACCTAGTTATGATAGC
AGATGCAATGAAGCAAATCGAAAGTCCTGATGTAGTTCTT
AAGAAACTTGGACAAACTTTACAAGAGGTTGTTGAAAAAG
GACAAGAATTTGTGGACAAAATGAATTTAAGTTTATTAGA
AGATATTGCCGCGGCCATTAACACGTTCTACCAGGAGCTG
ATGAAGATCATAGAAGACATTAGTGAGGCAGTCATCTTTG
GTTTTTCAATCCCTGCAATTAAAATATATGAAATTTCTCA
AAACATAGGGAAAGTGTTGAATGCAAATAATGGAATACAT
CAATTTGAGCTTCCTCTCCCATTTTTCCAGTAATATGGTC
ATTCTGAACAGAAAGTAAATTAAGTAAACACTACCATCTT
TTGAAATGAACATTCTTGGACATCGAAGCCAATGGACACT
TCACTGAAGTATAGTACAAACATGTATATAAAGCAATTAC
TGACTCAAAACATGTCTCATTGTTATGCTGCTCTATTATT
CTATTTGTATAAATGAGGATTGAAATACTAAGCTAGTTAT
CAAAAATGTCAACTGCAACCTATTGTCATCCTTGTTCTGT
ATCCAACATTAATGGCATGATGGATGGGGATCAATAAAGA
ACTTTTATTATGCAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
apobb.1-201 Contained in:
OTHER apobb.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006082 (1)
  • Ensembl_Trans:ENSDART00000133353 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK147233 (1) 784bp
    GenBank:BF158562 (1) 707bp
    GenBank:AW421880 (1) 670bp
    GenBank:BQ284231 (1) 658bp
    GenBank:AI793681 (1) 492bp
    GenBank:BM265610 (1) 484bp
    GenBank:BM265816 (1) 460bp
    GenBank:AI522358 (1) 430bp
    CITATIONS (2)