ZFIN ID: ZDB-TSCRIPT-090929-6174
Transcript Name: krt1-c5-002
Previous Name: si:ch211-236k19.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022950 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022950|OTTDARG00000018823|ZDB-GENE-060316-3 krt1-c5|no_translation CH211-236K19.3-002 LG_ BX255921.2 Danio rerio protein_coding NOVEL, 780 bp
CAATAAAAGCCAGCAGTTCCTTCCTGGACAAAATCACACA
CAGGAGCTGCCCAGCTTTTGGATACAATCCATGTTAGAAA
GAAGACATTGGAGAATGCTCGGATCATGCTGGAGATTGAC
AACGCCAAACTTGCGGCTGAAGATTTTAGGGTCAAATGGG
AGGCAGAAGCTACTCTTTGTCAGTCGGTTGAGAGAGACTG
TCACGCTCTCAGACGAGCTAAATCTGATCATGATCAGTTC
ATCACAACCCTTCGAGGAGATCTGGACAGTCTGAAAGAAG
AGCTCTATTTCCTGAAGAAGAACCATGAAGAGGAGAAGAA
CGCTCTAAAGAGCCGTCTGTCCAATGAGCAGGTGAACGTG
GAGGTGGACGCAGCTCAGGGCCCAGATCTGGGAGCCGTCA
TGGCTGAGCTGAGGGTTCAGTACGAGAACATCGCACGCAA
GAACAAAGAGGACGCAGAGATTTGGTATCTGAAAAAGCTG
GAGGCCGTGCAGTCGGAGGTGAAGGAAAGCAATGAGGCTC
TGCGATGCGCTCATTCTGAACTCAATGAAAGACGACGCTT
CCTGCAGGCGCTCGAGGTGGAGCTGGACAGTCTACGCAAA
CAGATTGGCGTTCTTGAAGGGAACCTGGAAGAGACGAATC
AGAAATACACTCTAGAGATGGAGCGTCTTCAGAGTTCACT
CACACAGCTGGAGGACGAGCTCTCACAGCTGCGCCTCGAC
ATGCAGAGAATCAAGACCGATTACGAGCAGCTGCTGCGCA
TCAAACAGAACCTGGAGCTG

krt1-c5 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA krt1-c5-002 780
mRNA krt1-c5-202 (1) 1426
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt1-c5-002 Contained in:
OTHER krt1-c5-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022950 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO925432 (1) 885bp
    GenBank:DV597389 (1) 741bp
    CITATIONS (2)