header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6146
Transcript Name: rps6ka4-201
Previous Names: rps6ka4-001, si:dkey-273o13.5-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022921 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022921|OTTDARG00000018802|ZDB-GENE-060526-284 rps6ka4|OTTDARP00000019118 DKEY-273O13.5-001 LG_ BX897741.9 Danio rerio protein_coding NOVEL, 2270 bp
CAAACCTCACAGGATACACTGAGAAAGTTGGCATGGAGAA
CTTTGAACTTCTCAAAGTGCTTGGCACAGGAGCTTACGGG
AAAGTGTTTTTGGTCCGAAAAATCAGCGGCCATGATAAAG
GCAAACTGTACGCCATGAAGGTGCTAAAGAAAGCAGCCAT
CGTTCAGAAGGCAAAGACTGCGGAGCACACTAGAACCGAG
CGACAGGTATTGGAGCACATCCGCCAGTCCCCCTTCCTGG
TCACCCTCCATTATGCCTTTCAGACGCAAACCAAACTGCA
TCTCATACTAGACTATGTGAGCGGAGGAGAGATGTTCACA
CACCTCTATCAGAGAGATCATTTCTCAGAGGATGAGGTGA
GGATCTATGTGGGGGAGATTATTCTGGCTCTGGAGCATCT
GCATAAGCTTGGCATTGTGTACCGAGACATTAAGCTGGAG
AACATTTTATTGGACAGTGATGGTCATGTGGTTTTGACAG
ACTTTGGGCTGAGTAAGGAGTTTCTGGAGGAGGAGAAAGA
GAGGACTTATTCATTCTGTGGCACTATAGAATACATGGCA
CCTGAGATTATCAGAGGGAAGTCTGGCCATGGCAAGGCAG
TGGACTGGTGGAGTCTGGGCATCCTGATGTTCGAGCTGTT
GACAGGAGCATCTCCGTTCACTCTGGAGGGAGAGAGAAAT
TCCCAGAGCGAGGTGTCCAAACGCATCCTTCGTTGTGAGC
CTCCATTTCCTTCCATCATCGGACCCTTGGCTCAAGATCT
CCTGCGGAAGTTGATAGTGAAAGACCCTCATAAGAGGCTG
GGCTCTGGGCCTCGAGGAGCTGAGGAGATCAAGGGTCATC
CTTTCTTTAAGGGTTTAAACTGGTCAGACTTGGCAGAGAA
AAAAGTCCAGAGTCCCTTCCGCCCTGAACTGCGGGATGAG
CTGGATGTGGGAAACTTTGCAGAGGAGTTTACAGGAATGG
AGCCGGTTTATTCCCCTGCCAGCACACCGCCTAGTACAGA
CCGTCTGTTTCAGGGCTACTCTTTCGTGGCTCCTTCGATC
TTATTCAATAAGAATGTGGTGATGGCGGATGTTTTGGATG
CTCATGTTAACGTTGACCGGCCTGGTTCTGCTACAGTCCA
GCGTAGTGCAATGCTGAAGGAGTCTCAGTTTTTCCAGCAC
TATGAGCTGTGTCTGCAGGGGTCTCCACTGGGTGAGGGCA
GTTTCTCAGTCTGCAGGAAGTGCAGACACAAGCAGAGCGG
TCAGGAATACGCTGTGAAAATCGTTAGTCGAAGGATGGAG
GCCATGACTCAGAGAGAGATCGCAGCTCTACGCCAGTGTG
AATCTCACCCAAACATTGTCACGCTCCATGAGGTCTATAC
TGATCAGTACCATACGTATCTGGTAATGGAGATGTTGCGT
GGTGGAGAGCTGTTAGAGCGAATCAGGAAAAGGAAGATGT
TTGCAGAATGGGAGGCCAGTCAGCTGATGAAGAGCCTGGT
GTCTGCGGTCAGCTACATGCATGAGGCTGGAGTTGTGCAC
CGAGACCTCAAACCGGAGAACGTGCTGTTCGCTGATGAGT
CGGATGAGTCTGTGTTGAAGGTTATTGACTTTGGCTTTGC
ACGGTTGTTTCCGGCGGGGAGCGGGAGTGCCCCTCTGCAG
ACCCCCTGCTTTACATTGCAGTACGCAGCGCCTGAGCTCT
TCCACAGCTCGGGATATGACCAGGCGTGTGACCTCTGGAG
CCTTGGGGTCATATTGTACACCATGCTCTCTGGCCAAGTT
CCATTCCAGAGTGAGAAAAAAGTTATGACATCATCGCACG
CTGCCGACATCATGCACAAGATCAAAGAGGGCGATTTCTC
ATTGGATGGAGAAGCCTGGAAGGGCGTGTCCGAGGAGGCC
AAAGATCTAGTGAGAGGTTTGCTAACCGTGGATCCTGAGC
GGCGGCTGAAGCTCTCGGCTCTGAAGGAGAACGCCTGGCT
TCAGGGAGGCGGCGTCATGTCCTCGACCCCGCTCTGCACC
CCTGATGTTCTGGAGTCCACCGGTCCCACCGTCCGCACTT
ATGTTAATGCCACCTACAAGGCGTTCAACCGGGGGAAGCG
TGAGGGTTTTTTCCTTAAAAGTGTCGACAACGCGCCGCTA
GCAAAACGGCGCAAGATGAAAATGACCAGTACTGGCGTGG
AGACCAGACGCAGCTCGTCTTCCTCCTCTTCCTCCTCGTC
CTCATCCGCTTCCCATTCCAAGACGCAGAATTGCCAATCT
CTGAATCCACACGAGGACCCCAAACTGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rps6ka4-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000022921 (1),  Ensembl_Trans:ENSDART00000065262 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CA472109 (1) 876 bp
CITATIONS (2)