Transcript

camk4-201

ID
ZDB-TSCRIPT-090929-6010
Name
camk4-201
Previous Names
  • camk4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000022719 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000022719|OTTDARG00000018672|ZDB-GENE-050417-76 camk4|OTTDARP00000018991 CH211-220B11.5-001 LG_ BX294395.15 Danio rerio protein_coding KNOWN, 2350 bp
ACTGAGGATACACACATTCACGGCCACTCAGCGCACATCA
CCAACATACATTACACTGAAGTGAAGCGCTGGAGATGCTG
AAAGTGACAATGCCCGCCTCTAGAGCCGCTCCTGAATACT
GGATCGATGGATCCAAGAAGGAGACGCTGGCGGACTTCTA
CGAGCTGGAGTCTGAATTGGGACGGGGAGCCACATCAGTT
GTGTACCGATGCCGTCAGAAAGGCACCCAGAAGCACTATG
CTGTGAAAATGCTGAAAAAAACAGTTGACAAGAAGATTGT
ACGAACGGAGATTGGTGTATTACTGCGCCTCTCTCATCCA
AATATAATCAAACTAAAGGAGATCTTTGAGACCCCTGCGG
AGATTAGTCTCGTGTTAGAACTTGTTACCGGCGGAGAATT
GTTTGACAGGGTGGTGGAGAAAGGCTACTACAGCGAACGA
GATGCGGCTGATGCAGTTAAACAAGTGCTTGAGGCAGTCG
CGTACCTGCATGAGAATGGTGTAGTGCACAGAGACCTGAA
ACCCGAGAACCTGCTGTATGCCACATCAGCGCCAGATGCT
CCACTCAAAATAGCGGATTTTGGTTTGTCGAAAATTGTTG
ACGATCAGGTAACAATGAAGACTGTGTGTGGCACTCCAGG
ATATTGTGCTCCAGAGATTCTGCGGGGATGTGCCTATGGC
CCTGAGGTTGACATGTGGTCTGTGGGAGTTATCACGTACA
TTTTGTTATGTGGCTTTGAGCCTTTTTTTGATGACCGAGG
AGACCAATACATGTTTAAACGCATACTGAACTGTGAATAT
GAGTTTGTCTCCCCCTGGTGGGACAATGTGTCTCTCAATG
CCAAGGACCTGGTGAAGAAACTAATTGTGCAGGATCCAAA
GAAGCGTCTGACAACACAGCAGGCGCTGCAGCACCCCTGG
GTGACTGGAAAGGCTGTTAACTTTACCCATATGGACACTG
CTCAAAAGAAACTCCTGGAGTTCAATGCTCGACGAAAACT
CAAGGCAGCGGTCAAAGCAGTAGTAGCTTCATCTCGATTA
GGCAGCGCAGGAAGCCATGGGAACCCAGATGGCAACAAAG
GCGACTGCAGCTCTTCCTCTATCAAAGAGAAGACAGCGGA
GGATCAGCCAGACACTGAACAGCCTCAGATTCAGAATGAG
GGCTCTTAAATCTCTAGAGCCTCACTGGAACTCGCACTTC
TTCCCTTCATGAAAGGAACGCGTTGCCTCATAGAGGAGAG
AACTGATGGGCTTTGTTTGGTTCTTCTGCATGCGGACTGT
GTCTCTATAGAAATGTCCCAACTCATGACCCAGCCAGTTG
CCATACCATGCTAACATCTGATCGGTATATAACTTCGGAT
TTTGTACAGCATCATTTGATGGTAATGAGAAGAACCAGAT
GGGCTTTACATCTATGGCAGTTAATATGTATGTTATCATG
CTTTTGCCAAACAATCGTAGTACTTTTGATGATATATGTT
GCGTTTTAGTTGACCAAATTACATACGTGATGCTTTTTAA
TTCAGATTTTTTTATTTATAAGTTATTGGTCGTTGGTAAA
GAAAGATACTGAACCGTACCTTTACATAAGCTTCAACTGA
GAATGCCTTATCATATAGCGTGTTTTTATATTTCATGAAT
TATTGTATATTTTAGAAATACTACTAAACGGTTTGTTTCA
AACTAAGATATAAGTATATTATTCCCTTTGTAAATAGAGA
GATGGTGATTTCTTCTTAAAACGGATGTAAATCTGTGTTG
AGAGCAGGATAACAGGCCTATCTGACACTCCACATCACTA
GGAAAAAGCCGAAATCTTCTTTATCTTGAGTACGCTTTTC
ACCATCTCATTGAAAAGGTTTTTATCTAAAAGACGTACCA
GTGATAGAATTCATCCCAGAATTCAGTGCTTTACCAAGGA
GTCTGTGATTGATTTTAAACACACCTAGAACAACATGGTG
GAGTTTTGATCTTTTTTCATACTGTATCTTTAAAGCATGC
TTGTAATGTATGGTTTGAGGGAATGCTGTTTGATAATCAC
ATATAAGCAATGTAATAAGGATATACAGTACAGGGGTTCA
TGTTTTGCATGTAGGAATGTTTATCTTAACTTCTGCAGTC
GTCTTTTTAAATGCACTGTATTTTACAGATAAAACTCACT
GTCTAATTAACAGTATGCTATCAGAGGCCATTTGACGGTC
ACTTTGTATATGACACTAGTGTGTCAACTTTGTTATCTGC
CTGTTTCTATGTCTAAGGACTCAAAAATGCCAATAAAACA
GCACTGTATATTACTTGCAGAAATAAAGAGTGCAAAACAG
TCCAGTGTGTATCACTGTGCAAGTTCTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations