header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-592
Transcript Name: cyp2p8-201
Previous Names: cyp2j23-001, cyp2p8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005967 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005967|OTTDARG00000005502|ZDB-GENE-061030-1 cyp2p8|OTTDARP00000005342 cyp2p8-001 LG_ BX322665.5 Danio rerio protein_coding KNOWN, 1867 bp
ACTGCTCAACAAAACAGGAAACATCCGTCATGGACTTGTG
GTACCTTTACGAGTGGATCGATATCAAAAGTATTTTGATA
TTTCTGTGTGTGTTTTTATTGCTGGGTGATTATATAAAAA
ATAAAGCACCAAAGAACTTTCCTCCTGGACCCTGGTCTTT
GCCGATAATAGGAGATCTTCATCATATCGATAATAGTAAG
ATTCATCTTCAGTTCACAAAGTTTGCAGAAAGATATGGCA
ATATTTTCAGCTTTAGACTTTTTGGACCAAGAATTGTGGT
GTTGAACGGGTATAACTTGGTCAAAGAGGTGTATATAAAA
CAAGGAGACAACCTCGCTGATCGACCAGTGTTACCACTAT
TTTATGAAATCGTTGGAGACAAAGGTTTAATTCTTTCCAG
CGGATATAAATGGAAGCATCAGAGGAGATTTGCACTCTCG
ACTCTTCGAAATTTCGGATTGGGGAAGAAAAGCCTGGAGC
CATCTATCAATGTTGAATGTGGCTTTCTGAATGAGGCCAT
CTCAAATGAACAAGGTCGACCCTTTGACCCTCGCTTACTT
CTGAACAATGCTGTCTCAAATGTGATCTGCGTGCTGGTGT
TTGGTAATCGATTTGACTACAGTGACCATCACTTCCAGAC
TCTGCTGAAGAACATCAGTGAAGCTGTGTATCTGGAAGGA
AGCATCTGCAATCAACTTTACAACATGTTCCCATGGCTCA
TGGAGCGACTGCCTGGACCACATAAGACAATTATTACTCT
GTGGCGGAAGGTGACTGACTTTGTTCGAGAGAAGGTGAAT
GAACACAGAGTGGATTATGATCCATCAAATCCTCGAGACT
ACATTGACTGCTTTCTAACTGAGATGGAAAAGCTCAAAGA
CGACACAGCTGCAGGGTTTGATGTGGAGAACTTGTGCATC
TGTTCTCTGGATCTGTTTGTAGCAGGAACTGAGACCACCT
CCACCACTCTGTACTGGGGTCTTCTCTACATGATAAAATA
TCCTGAGATACAAGCTAAAGTTCAGGAGGAGATTGATGCC
GTTGTTGGAGGCTCAAGGCAGCCATCTGTATCAGACAGAG
ACAACATGCCCTACACCAATGCTGTCATTCATGAGATACA
AAGGATGGGAAATATAGCCCCAATAAATCTGGCCAGGAGT
ACTTCAGAAGACACCCAGATAGGAAATTACTCTATTCCAA
AGGGCACAATGGTGACCAGTAATTTGACATCAGTGCTGTT
TGATGAGTCTGAGTGGGAGACGCCTCACTCTTTTAACCCG
GGTCACTTCCTGGATGCTGAGGGCAAATTCAGGAGGAGAG
ATGCCTTTTTACCTTTTTCTCTAGGAAAGAGAGTGTGTCT
TGGGGAGCAGTTGGCGAGGATGGAGCTCTTCCTCTTCTTT
TCCTCTCTGCTGCAGCGCTTCACTTTCTCTCCACCAGCGG
GTGTGGAGCCCAGCCTGGATTATAAAATGGGGGGCACACA
CTGTCCTAAGCCATTTAAACTGTGTGCAGTTCCACGCTAA
ATTAAGAAACACTCATGCAAACCTTTCAGCAATTTTAAAA
GATACATTTTTACATTCAAGATTATTTGATGATTTATAAA
ATACAAAACTACTTACAAATAAGCCTGTATTGAAAACAAA
GAGATTAAGGGGATAAATTGTTGTGTAAACTCAAGATCTG
AACTGTGAACTGAGCTCTGGCATCAGGAGAAAGAACTGTG
AAGCAGTCCAGACCTGAAAAAGTGAGAATGAGAGAATGTT
TAGCAATGCGTACAATAAAACTGCACTGTAGACTAATGTT
AAGATGTGTAGGTCTGCAGATTTTAGAGAAATATAACTAA
AATATGTGGTATTTGATGACATCATAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cyp2p8-201 Contained in:

OTHER cyp2p8-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005967 (1)
  • Ensembl_Trans:ENSDART00000063108 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056816 (1) 2347bp
    GenBank:BC049521 (1) 1704bp
    CITATIONS (2)