header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5789
Transcript Name: fsta-202
Previous Name: fsta-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022443 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022443|OTTDARG00000018483|ZDB-GENE-990714-11 fsta|OTTDARP00000018805 fsta-001 LG_ BX537294.4 Danio rerio protein_coding KNOWN, 2024 bp
GTTCATTCAGCACTGCCTGAGTAAGAAGATTACTTTTGCG
CTGCTCGTCTATCTACTCTTTCTCTCTTTAAACATGCTAA
GGATGCTAAAGCGTCAGCAGCTCCACCCGGGAATGATTTT
ATTACTCTTTTGGCTCTGTTATTTGATTGAAGATCAAAAA
GTGCAAGCTGGTAACTGCTGGCTTCAACAGGGCAAGAACG
GGAGATGTCAGGTTCTCTACATGCCTGGGATGAGTCGGGA
GGAATGTTGCCGGAGTGGGAGGCTCGGTACATCTTGGACT
GAGGAAGATGTGCCAAACAGCACATTATTCAGGTGGATGA
TCTTCAATGGCGGGGCTCCAAACTGCATACCTTGTAAAGA
GACGTGTGATAATGTGGACTGTGGTCCTGGAAAGAGATGC
AAAATGAACAGGAGGAGTAAACCTCGCTGCGTCTGTGCTC
CAGACTGCTCTAACGTCACCTGGAAAGGGCCCGTCTGTGG
CTCAGATGGAAAAACATACCGGGATGAATGTGCCCTTTTG
AAGTCCAAATGCAAAGGGCACCCAGATCTGGAGGTCCAGT
ATCAAGGCAAATGCAAAAAGACGTGTCGTGATGTCCTGTG
CCCGGGAAGTTCAACTTGCGTGGTGGACCAGACAAACAAC
GCCTACTGTGTGACATGCAACCGCATATGCCCAGAGGTCA
TGTCTCCAGATCAGTACCTTTGTGGCAACGATGGGATTGT
TTACGCCAGCGCATGCCATTTAAGAAGAGCCACGTGCTTG
CTCGGTAGATCCATCGGCGTGGCATATGAAGGAAAATGCA
TCAAGGCCAAGTCATGCGATGATATCCACTGCAGTGCAGG
GAAGAAGTGTTTATGGGATGCAAAGATGAGTCGCGGGCGC
TGCGCAGTTTGCGCCGAGTCGTGCCCAGAAAGTCGCTCGG
AGGAAGCTGTGTGCGCCAGCGACAACACCACGTATCCCAC
CATTACGGAAGACCAGGAGGATGACGATGACGAGGAAGAC
CAGGACTACATGGCTTATGTCCAATTATCACCTGTACTGG
ATGGATAAAGCACCATCAACCAGTGGAACAGTCCTAGGGC
GAGGAGTCATGTCCACACTGTACATATGTGTATGCTAATT
TATTTTTCAGAGAAAAAAGAAAGAAGTATACATGTAGTTC
AGTCTGCTTGATGTTTATTTATACAGTGTTCTGTTTTATA
ATTTATACATTTACAGTGTCCGGCTTACTTGTCTATCATG
TTTTTCCCTTTTCTTTCTTTAGTTTTGTTTTTATATATAT
TTTTTATTATGACCGAGAAATATATTTGTCCAAAGAGAAG
CAGTGTTATTTATTGTGAGGTAAAATGCTATCATGTAAAG
TGTGAGTCTTCTGCAAGCTGTAAATTGCATTCCTTGAGCT
GTACAAATGCTTATCAGTGTCAATTCTGTATCACAGATGT
TTATTTCACACATACCTGCATGTTAGCTTGTGTTTATTTA
TTGGAAAAAAATGGAAAAACGCATAGGACAAAAAAAAAAG
TGTCACTCTTTAATGTACGTGTATATTTCTGGTTTTGTTT
ACAGTTCAGTGTAACTGACCAAAGGGATTTTCTTAAATGT
TCTTCAATGTTAATGTGATATGGTGCAGCAGGATGACATT
GGAAATGTGTTGTTTCTCATTTAGAAAAGCCCTGCTGATT
CTGCTGTCCTTCATAAACAGCAAGAAATGGGCAGTGGGTG
ATGATTGTTTCAGAAAACTGTGCCATGCAACTGTTTTTGT
CTTGTTTTTGCCAATATTCAGCTCTATATTGCTCTTGCGG
AGCGAACACAAGGTCAACGGAGGACTCAGTATCGATATAT
AAAGCGTTCACCTTTTCACTTTGTTGTTGAAATGCTTTTT
TTTATTTTCAGACATCTCAAGATAAAAACGAAATTCAGTT
ATAAATATATAGTTTTGTATTTTTTATGTAAATGTCATAT
GTATATACAAAGTTTGATGTATTTGTACAGATATTAAGAG
TGAAATCAATAAAAAATACTTATC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fsta-202 Contained in:
OTHER fsta-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022443 (1)
  • Ensembl_Trans:ENSDART00000146237 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ317968 (1) 3540bp
    GenBank:BU670730 (1) 3518bp
    GenBank:BC078241 (1) 1260bp
    GenBank:CO927169 (1) 865bp
    GenBank:CN831767 (1) 832bp
    CITATIONS (2)