ZFIN ID: ZDB-TSCRIPT-090929-573
Transcript Name: tmem179-201
Previous Names: tmem179-001, zgc:101058-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005894 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005894|OTTDARG00000005435|ZDB-GENE-040808-25 tmem179|OTTDARP00000005276 tmem179-001 LG_ BX255913.8 Danio rerio protein_coding KNOWN, 1154 bp
ATGCAGTCGCCGGGAACGATGGCCGTCGATAATTTTCTCT
TCGGCCAGTGCATCCTTTACTTTTTAGCATTTCTTTTCGG
TTTCATCGCCGTTGTACCGCTCTCTGAAAACGGCGATGAC
TTCCAGGGGAAATGTCTGCTGTTTACTGAGGGGATTTGGC
AAAATGAGAACATGACGATGGGGAAACAGCGCTTTATAGT
TGAAGAATGGGGACCAGAGTCATCCTGTCGCTTCATCACT
TTCGTGGGCATCGTGTCTCTCATCCTCTCTGCCGTGCAGG
CGTGGCGGACCTTTTTCTTCCTCTGCAAAGGCCACGACGA
CTCCCTCTTCCATTCTTTCTTGAACCTCCTCCTCTCTCTG
TTAGTGTTATTTGTGGTGTTTGTGGCCGGTACAATCTCCA
GCGTTGGGTTCAGTATATGGTGTGATTCTGTCACTGAGAA
TGGAGCAATGCCTAGCAGCTGTGAAGATCTACAAGACACA
GATTTAGAGCTCGGCGTTGAAAACTCATCTTTTTATGACC
AGTTTGCCATTGCACAGTTTGGCCTGTGGTCGGCCTGGTT
ATGCTGGCTAGGTCTAACAGTGCTGGCCTTCCTGAAGGTT
TACCATAACCACCGACAGCAGGAGCTGCTAGAGAGTCTAG
TTCAAGAGAAGGAGCTTCTGCTTGGTCATCCTTTACAGAG
GAGTTCTTATGTGTACAACAGGAACGCCATGATTTAATCC
AACATACATAGTAATCCATTTGCACTGCATGAACCACTTT
CTGAGAGCAGAAATAAGCCCTCAACATCAACATATTTTTT
AATAAAAAACATATATCACAGATTAGAGTAAGTCGTTAGA
GTCATTACAATATATATATATGGTCATGGAGCAGGGTTAA
AATATTTCTCTTGTTTCAGACATTTCATCAAGCTGTACAT
GTTCATATTCACTCTCATTTTCACAGTATTAAGGCATAAG
AAGACTGATTAATTGTGTTGTATCTTTTAAGAAGCCAGCT
GTGCATTTATTAGGCTCAGTAAAGCGTTATGAGGACACAC
TTTTAACAGAAGTCGCAGTTTCAATAAGTTCACTCAGACG
TGACATATAAATTCTGCTACCGATACAAACTACTGCATTT
ATTGTACATTTGAAATAAAGCTGAATTATTGCTC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem179-201 Contained in:
OTHER tmem179-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005894 (1)
  • Ensembl_Trans:ENSDART00000005473 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078227 (1) 1185bp
    GenBank:EH610591 (1) 846bp
    GenBank:CN840928 (1) 834bp
    CITATIONS (2)