header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5467
Transcript Name: bag2-201
Previous Name: bag2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022025 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022025|OTTDARG00000018210|ZDB-GENE-040426-1399 bag2|OTTDARP00000018502 bag2-001 LG_ BX004843.10 Danio rerio protein_coding KNOWN, 844 bp
CCGGTGTATTTCTCGGCTTTTCCGTTGTGGTTTTTATCCT
ACAGATCACCGCACCCGTCGAATCATTCATTAACCGACTG
TTTAGCAGCATTAGCAGCGATGGCACAGGCCAAAATCAAC
GCTAAAATGAACGATGCAACTAAAAACAAATTCACCAGAA
CCATGTCAATGGCTGACCGGTCCGGACGGCTGCTGGAGAG
CCTGGATCAGATTGAAATGAGGGTTGAAGCTCTGCGAGAA
GAAGCCTCAGCGATGGAGCAGGAGAGAGAGTGTTTGATCG
AGATGATCCAGTCCATACAAAACAGCCAAGAAATGAGGAG
CATCTGTGACGGAGAGCGAGAAGAGCTGTCTCTGACCGCC
GCCAGACTGATGGGCAGGACGCTGACAGTGAAAGTCTCTC
TGGAGACCATCAGAAACCAGCAGCAGGAGGAGGCCTTGCA
GAAAGCCATGAAGATGATAGATGAGATCACAGAGAAGGTT
CTGGAGGATCTGCAGTCAGCCAGGACTCGTCTGGAGGCTC
TGCATGCTGCGTGTGTTTCTGACGCACCGCCGGTGCCTGT
GGATCAGAAGTTTCAGAGCGTGGTGATCAGCTGCGCTCTG
GAGGACCAGAAGAAGATCAAGAGACGCCTGGAGACTCTCA
TCAGGAACATGGACAATGCGGAGAAGACCATTCAGATCAT
GGACAACCCGAAGGTGGATCTGTCCAAGCTCGCCAATGGA
AAATAAGAGCTCACAGGTTCTGGAAGTACAGAAATTATTC
AGCCTTGTTTGCCTGCCTTACTACATCCAATCAGCTCACA
GTAAAAAAAAAACAAGCCACACCCACTGTTTTCTCATTTA
TTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bag2-201 Contained in:
OTHER bag2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022025 (1)
  • Ensembl_Trans:ENSDART00000049684 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053303 (1) 2136bp
    GenBank:CA475844 (1) 884bp
    GenBank:CA475854 (1) 869bp
    GenBank:CK139180 (1) 845bp
    GenBank:CD755235 (1) 761bp
    GenBank:CD280184 (1) 597bp
    GenBank:CD282211 (1) 587bp
    GenBank:CD280183 (1) 380bp
    CITATIONS (2)