header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5466
Transcript Name: ifngr1l-202
Previous Names: crfb13-001, ifngr1-001, si:ch211-165e15.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000022024 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000022024|OTTDARG00000018209|ZDB-GENE-071120-8 ifngr1|OTTDARP00000018501 CH211-165E15.2-001 LG_none CU571174.10,BX004843.10 Danio rerio protein_coding NOVEL, 517 bp
GAATTCACTTACAGCACAGATTTTTACAATGAGAAAACCC
ACAAGTGCACTCTGGATTTTCCAGCTGTGGATGCGTCTGT
GCACAAAGATGTGATCGAGGTTTCCTTCAAGCATCCTTCA
GCATTTTATGAGCGGGCCAGCCTGGAGGAGGAATTCGAAT
ACACCATCATCCTTAACCCATCCTCATCCTCTGTTCCTCA
TCTCCAGGAAAAGTCCTCGCACTCATGCTTTGAGGATGAG
CTTGGGTATTTGTGCGAAACAAAAGTCCACGTGAACCAGT
CTGTGGTCGTTCAGTGGGTGGTGCTGAAGTTTGAGGGGAA
AATCGCATCTATACCTGTACACACCTATAAAAATGTGTCT
GTGCCTCAGCTGGAGCCTGCCTCAGCCAAAACAGAATGGA
TTGCAGCTATTCTCTGTGGATCAATCGCATTGCTCTTCAT
TGTTTTCGTCGTTCTGTGGTTCATCCACAAAAATTTCTCC
AAAATACCCAAAGTTCCCTCCATCCTGCGTAACATTG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ifngr1l-202 Contained in:
OTHER ifngr1l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000022024 (1)
  • Ensembl_Trans:ENSDART00000146082 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AL927276 (1) 510bp
    CITATIONS (3)