header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5435
Transcript Name: adgrg7.1-201
Previous Names: adgrg7.1-001, si:ch73-162i18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021950 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021950|OTTDARG00000018156|ZDB-GENE-060503-894 adgrg7.1|OTTDARP00000018450 CH73-162I18.1-001 LG_ CR956626.9 Danio rerio protein_coding NOVEL, 558 bp
TCTGCCAGCCGTTATTGTTGGCATTTCGTTGGGTTCCACC
TACAGTGTAAAGGAGCCATTAGGTTACCGACAGGAAGAGT
TTTGCTGGCTGGCTGCACTAGACCACAATCTGAACTTCAG
TATGGGGAAACCCATGTTTTGGGGATTGGTGCTCCCTTTA
CTGCTCATGCTGATCTCAAACGCAGCAATACTGCTGCACT
TCTCGCACAACATCTGCAAGACAAATCCAAACTTAGGCAG
GTCACGAAAAACCCCTCTAAAGAATAAGATTTTGAGTAGT
TTCTCTCTGGCAGTGATGCTCGGCCTTTCCTGGTCCATCG
GTTACATTTTGCTCATCGTCCGTGATTCATATCTGCAATT
TCTTCTGACTGTGGTTTTCTGTGTCTTAAACACAACACAG
GGTGTTCAAATACTGATTTTATTCACTCTGAGGCCTGTAC
TGAAAGCGCATCCAGCTATTCTGGCAGCTCTGCGTCCATC
AGCAATAAGCCTTCACAGGAGAACATTTTATTTATGGAAA
AATAAGACACCAGATAGCCATGAAAGCTATATATCCAC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adgrg7.1-201 Contained in:

OTHER adgrg7.1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021950 (1)
  • Ensembl_Trans:ENSDART00000146969 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES No data available
    CITATIONS (2)