header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-54
Transcript Name: atad1b-201
Previous Name: atad1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000002049 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000002049|OTTDARG00000001918|ZDB-GENE-030616-44 atad1b|OTTDARP00000001806 RP71-1G13.1-001 LG_none AL731788.8,BX548001.17 Danio rerio protein_coding KNOWN, 1283 bp
AGAAGAAGAAGAAGAAGAAGAAGAAGAATGAAGAGGTGGG
ATGACAGTGTTTAACGTTAGTTAAAATTCTGACCGCTGAC
AATAAACGGATGTAATAAAAGGAGTCTGCCTGTTAAACCA
GTATTTCCTTGACCCAACAGAATAGACATTCCTGGTGAAC
GTGAGAAGATGGTTTTGAAAGAAATTCCCACAGAAAACAT
AACTCGCCCTTTGGGCCGGAATGAGGTCATAGGTTTACTC
TTCCGTCTCACAATATTTGGCGCTGTCACCTATTTTACAA
TAAAGTGGATGGTTGATGCTATCGATCCAACAAGAAAACA
AAAGGTTGAGGCACAAAAACAGGCAGAGAAACTCATGCGG
CAAATTGGAGTGCAGAATGTGAAGCTTTCTGAATATGAGA
TGAGCATTGCAGCTCATCTTGTGGATCCGTTGACAATGCA
GATTACATGGCATGACATTGCTGGTCTGGATGAAGTCATT
ACTGAACTGAAAGACACCGTTATACTTCCAATCCAGAAAA
GGCATCTGTTTGAAGGATCCAGACTTCTTCAGCCACCCAA
AGGTGTGTTGCTGTATGGGCCTCCAGGCTGTGGGAAAACT
CTCATAGCCAAAGCTACTGCCAAAGAGGCTGGTTTCCGTT
TCATCAACCTGCAGCCATCCACTCTCACAGACAAATGGTA
CGGAGAGTCCCAGAAACTGGCTGCAGCCGTGTTTTCACTG
GCCATCAAGCTACAGCCCTCCATTATCTTCATCGATGAGA
TTGATTCCTTTTTAAGGAATCGCTCAAGTTCAGATCATGA
AGCCACGGCTATGATGAAGGCTCAGTTCATGAGCTTATGG
GACGGCCTCGATACTGACTACAACTGCCAGGTCATAATAA
TGGGAGCCACCAATCGGCCACAAGATCTCGATTCTGCTAT
TCTCCGAAGGATGCCTACAAGATTCCACATCAATCAGCCT
AATGTCAGGCAGAGGAAGGACATCCTGAAGCTGATCTTGG
AGAATGAGAACGTGGAGTCCGCTGTGGAATTAAGTGAAAT
TGCAAAGCAGACTGATGGGTTTTCTGGAAGTGACCTTAGA
GAGATGTGCCGAGATGCTGCTCTTCTGTGTGTGCGTGACT
TTGTTCACCAAGAAAGTCCAGAGGAAGACTTCATCCGTCC
CATCAGGCAGGAAGACTTGCAGAGGGCAATCGAGAAAATG
AAGAAGTCCAAATCTGCAGGAGTGCATGAGGCATTTATGC
AAGTACCACTGGACTAATCCCGATGCTGCTGTTTTAAAAA
AAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atad1b-201 Contained in:

OTHER atad1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000002049 (1)
  • Ensembl_Trans:ENSDART00000079130 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095151 (1) 1290 bp
    GenBank:BC164188 (1) 1156 bp
    CITATIONS (2)