header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5298
Transcript Name: glipr2-202
Previous Name: glipr2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021708 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021708|OTTDARG00000017968|ZDB-GENE-030131-4424 glipr2|OTTDARP00000018261 DKEY-2N12.1-001 LG_ CR855258.6 Danio rerio protein_coding KNOWN, 3435 bp
ATTAATTTGCGATTATGAGTGTATATGTGTGTGTGTTTGT
GTGCGTGTCTGTTTAGAAGGAAACCAAGCATGAAAATGCG
TGTGTGTGTGTGTGTGTGTGTTTGTGTAGTAGGCTACCAT
CAGAATGCACTTCCCTGGTCTAGAGGGCGTTGCATCACTT
GACAGATATATAGTACGGAGATTTAATGTGCAAGACAGAG
TTGGCAGACAGCGCTTAAAGAAAGACAAATTCCTGCCTTT
GAGCAACCAACAGAACAGTTTCTCACGTAACTACATGCAT
GGCGGGCAGCAGTTTTGAGGCCGAGTTCCTACAGGTGCAC
AATGCCTACCGCAAACAGCACGGAGCTCCGCCCCTCACCT
TTAACAAAAACCTGTGCCGCTCCGCACAGCAGTGGGCGGA
GCATCTGCTTTCAACCAAAACACTCGCACACAGCAACAAG
GGCTACGGAGAAAATTTGTATTATGCTTGGAGTTCAGCTA
ACAAAAAACTCACAGGACATGAGGCAGTGGACAGCTGGTA
CGGTGAAATTAAAGACTACAACTTCAGTAGGCCAGGATTT
AGCTCCAAAACAGGTCACTTCACACAGGTGGTGTGGAAGG
ACACAAAAGAGTTGGGAGTTGGACTGGCCACTGATGGGAA
CACAATTTTTGTCGTGGGTCAGTACCTTCCCGCTGGAAAC
ATCGCAAATGCAGGTTATTTTGAAAAAAATGTCCTGCCGA
CTGGCTCTAAACTAGATCAAAAGTCCACTGGTGCAACTCA
CAAAGTGGAACAAGCTCATGGTTCATCAGGCATTCATTCA
AACAAAGTGCCCTCAGTGCCTCACATTGCTGAAAAACCAA
CACCAGAGGGCAAAGCAGAAAGCAGTTTTGAGGCAGAGTT
CTTGCAGACCCACAATGCATATCGAAAACATCATGGAGCT
CCACCCCTTACCATAAACATAAACCTGAGCCGCTCTGCAC
AAAAGTGGGCAGAGCATCTGCTGTCAATCAGGACTCTCAT
GCACAGCAACGGAGACCATGGAGAAAATGTGTATTATGCT
TATAACTCGGCTAACAAAAAACTCACAGGACGTGAGGCAG
TGGAAAGCTGGTACAATGAAATTAAAGAGTACAACTTCAG
CAGGCCTGGATTCTCCTCTAAAACAGGTCACTTCACACAG
GTGGTGTGGAAGGACTCAAAAGAGTTGGGAGTTGGACTAG
CCACTGATGGAAGCACAAGTTTTGTGGTGGGACAGTACCT
TCCAGGAGGTAACATCACAAATGCAGGTTATTTTGAGAGA
AATGTCCTACCGGGGGGATCCAAAGTAGACCTCAAAGCCA
CCCCACCTGTGGACAAAGTTGGACAAGCTCGTGGTGCCCT
TAGCATTACGTCCAACCTGTTGCCTTCATCATCTCACAGT
GTTGGACCAGCACCACCGAAGACTCATTCTCCACAGAGCA
GCCACTCAGAGAGTGAGAGCTTGTTCCAGTTTCGTCAGTC
TCTCCTTAAAGCTGTAAATGATTACAGACGACAACATGGG
GCAAAACCTCTCTCTCTGTGCCCTGTCCTCAGTAAAGAGG
CTCAGGATTGGGCAGCACATCTAGCCAGCATTGGTGCCCT
ACAGAACAGCAGAAAAGGTTACGGAGAGACTTTGTCTTAC
AAATGGACATCCAGTATGGTTCCTCCAACAGGAAAAGAGG
TTGCTGAAAACTGGTACAAGGATAATGTGAAGTACAACTT
TGCCATTCCTGGATTTCAGAAAGGAACTGGTAACTTTACC
CAGATGATCTGGAGGTCTTCAGAGCAAGTTGGTGTTGGTT
TGGGATCAGATGGAAAGGGCATGTTCATTACTGTGGCCTT
CTACAACCCTTCTGGAAACATCACCAACCCTGGCTTCTTC
CAGGATAATGTCAGACCTTCTGGGAGGTGACCTGCTGAAT
AAGAAAGATTAAGAAAATTTTGCATCTTGTTTTACTTGCT
AGTTTATAAATTTTTTAAAGGCATTTATCTCAGGTTTAGT
GTTTGCATAGTTACTGCACTTTGCCTTTGTAGGGGAGAAT
ATGGCAATATATTCATACAGTATGTTTGTCATCTAAATAT
ATATCATAAACATAAACATCAGTTCACAAATTTTAGCTGC
ACCGTTGAATGTAGATGCTTTTTTAAAGGTTCTGGTGTAG
ATAAATGAATATTATTTGCTTAGGTGGTTTTCTTTCCTTT
ACCCTAATAAGCAATCGCATGCACCTGCTATAGATTTGCA
TGATTGGTTTTAATGAGAAGTGACTTCAAATGTATAGAAA
GATGAGGTGATAAATCATAATGAAACATTAAAATGGATTT
TGCATATTATATATGTTTAAATATGTTGCTTTAATAAAAA
TGTTTGTAAAATTCAAGTAATTTCTGCAGTTTGACAGATA
TTAAACACTGAAACTTTTCACTAAACAGTGCTAATAGAGA
CTATAAGCAAAAGGGAAGATAAATTATATTTTAAAGAATC
TGTGTTACTGTACAACAAACCTGAAAATAGGAATCAAGGG
AGAAAAAACAAGATTTTTAAAGCATTTCCCTAAATTATCA
TGAAATATATTGTAAATTCAATCTGTAAAGCAGTATGAAA
ATGAAGAATGGATAAATGCACAGAACATCTTGTCAGTACA
AAAAAAACTTTGAGATATGTTGCTGCTGAAAGTTATTTAA
CCTCTTTCCTACACAGAGAGACTTGTACTTTGACTTCTCA
TTTAATAATTTTTATCCTGTAAAGACTGTATATTCTGTCT
CCCTTCCCAAAACCTCACATAAAACATTGTACATTTTATT
TTAATCTGTTTGATTTATTAGCTGTTTTCCTAAAAAACAA
ACAAACCTATATGTGATGAATACAAAGTATCCCCTGCCAC
ACACATGCACACAGACCCTCATAGATTGCATTCTTATACG
CAAATGTTTATCAACATATGCATCTAGATGTGCACATCTA
TCTTGCACAGCACCATAGAGCTTGGGTGGGAATGCGAAAT
TGAATTGACAAGGTGTCATGTTGCATAAGCCTCTCAGCAC
ATTGTGTTGCTGGAGACACATGAGATGCTCTGATCTTCAT
TTATACATGCCCTCTTTCACGAATACACAGGCTGAATAAA
ACAAAGGTCAAACACTTGATCAGCTAAAATCCACAGACCT
TTACTGTGGTGGGGGTCTAGTTTCACATTGGAAAAAAAGG
AAAAACCTTATTGAAATGTAAATATTACTTTATCAATAAT
AGTCTTTAGAATAAAACATTTCAAACAAAACACATGAATG
CTGCATTATAAAACAGGAATATGCACAATATTGAACAGCA
TTCAAGGCTTTTTCAGACTTATGCATTTGTTAATACAATT
CTACTTGAATGGATGTGTTTTGTCTGGTTAAACTGAAATT
TTTTTTAAATAAAATAAAAATTCAGTGTATTATAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
glipr2-202 Contained in:
OTHER glipr2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021708 (1)
  • Ensembl_Trans:ENSDART00000141361 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056553 (1) 2684bp
    GenBank:CA474509 (1) 920bp
    GenBank:CV480493 (1) 895bp
    GenBank:CV480499 (1) 759bp
    GenBank:CK237752 (1) 670bp
    GenBank:AI958856 (1) 514bp
    GenBank:CD590142 (1) 500bp
    GenBank:AI957744 (1) 448bp
    GenBank:CD605628 (1) 327bp
    CITATIONS (2)