header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5203
Transcript Name: usf1l-202
Previous Names: usf1l-005, usf2-005

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021537 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021537|OTTDARG00000017857|ZDB-GENE-040426-2269 usf1l|OTTDARP00000045553 usf1l-005 LG_none BX276128.8,BX942832.5 Danio rerio protein_coding KNOWN, 772 bp
ATTACTCTTGTAGATGGGTTTTAGCTCATTTTTTTGCGAG
TTGTTTGCATTTCTCTTTGTTTACCTGGCGTTAGCTTGTA
TGCTAAATGCGGCGGTGTGTTGGTAGTTAATCGTGACTAA
TTCTTGTGCTGCTGATATAATTAACCTCGCATCTATGTGT
AGAAAGTGGCTTATGGAGAACTTGTATCTTTATCAGTTAG
GATGGTGCGCTTTTTATAGCTTTGCATGAGTGGATTTTTA
CGTTTGAGGTCATCAGCTGAAACACAGATCAATATTTGCT
CACAAATATGACAAAACGGAAGGGTTCTGATCCTGAAGAT
TCTCCTATACTGCAGGACGGTGTTGCTGACACAACAGATG
ATTCACTTGCAGTCACAGCCATCCAATCAGCTGCTGCATT
TTCAACAGACCAGCAAATTAAGTATCATTTTCTAAAAGCG
GAAGCAACAGGGGGACAGGTTACATATCGCGTCATCCACT
TGGCTGATGGGCAGGTCGAAGGCCATGCAGATGGAGCTGC
AGCAGTCAGTGTGGTGACTGGGTTTCCCACAGCAACACAG
GCAGCCACACCTCCTACTGTAATGTCGGAGAGTGTGGAGG
GAGAAACATCTGAAACTCAGTACTACTATCCTGCCACCCT
CTCTGACACAACTGCTGGTGCCATGGTAACCGGTCTCCAG
ACAGCTGATTCGGTACTATCTCAGCCTACTTCTGCAGGTC
AGCTCTATGTAATGATGTCACCGCAGGATGTTCTCGCCAC
GACGCAGCCGAG

usf1l TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA usf1l-002 (1) 716
mRNA usf1l-201 (1) 1650
usf1l-202 772
usf1l-203 (1) 756
usf1l-205 (1) 757
usf1l-206 (1) 920
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
usf1l-202 Contained in:
OTHER usf1l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021537 (1)
  • Ensembl_Trans:ENSDART00000134900 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO922933 (1) 805bp
    GenBank:BI886749 (1) 797bp
    CITATIONS (2)