ZFIN ID: ZDB-TSCRIPT-090929-510
Transcript Name: chac1-201
Previous Name: chac1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005551 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005551|OTTDARG00000005140|ZDB-GENE-030131-1957 chac1|OTTDARP00000004962 chac1-001 LG_ AL929049.4 Danio rerio protein_coding KNOWN, 1562 bp
ATACGCCCATAGGCAATGTTGCATATAGCCTGCCTCAGAG
CAGCCCACATTTCATCATCCGCCGAGGACGAAAAGCAGCG
CGGCAGCCCGGGGTGCGCGAAAACAACGGTTAAAAGGTTA
TTCGATCCGCCTTTACAGCACCGTATGATTGGCCGGGTAG
AGGTTTGTTGATAAACAGGAGGCTGGCCGGCGAGCTAGCA
ACAGCTTTTTGTGTTTTATTCCGATTGAAAGAGCCGAAAA
GGCCAAGATGGAGTTTTAAGGCAATGATGCGGTAACTGCA
CGGCATAGGCATGCACCAGGCAAAGAAAAGCGTTTTGCGA
GACTGCACCATCACAACTGCTAAGCAGTTGGGCTCTGATA
CCGTCCGCGGTATAGCCGTGAGCCAACCCATACCTCTTCT
CCTTGATAGGAGGAAGCTAACGCTAGCTACCTAGCCTGTG
GCCCATTCATTTAGCTGTTTTTACATCAAAGCGCACACTA
TTACCTTTTCTACACTCATACCATCCTGTAAAAGATGAAA
CCTCAAGACATCGTCGCTGGAAAATCCAGCTTGTGGATCT
TCGGCTACGGCTCGCTGGTCTGGAAGCCAGACTTCAAGTA
CAAGAGGAGCAAAGTCGGTTATATTAAGGGGTACAAGAGA
CGCTTCTGGCATGGGGATAACTTTCATCGTGGAGATGATG
AAATGCCCGGAAGAGTGGTGACGCTCATCGAGGAGGATGA
CGTGTGCACCTGGGGTGTTGCCTTCGAGGTGACTGGCTCT
CAGATGGAGGAGTCTCTCAAGTACCTGAACGTGAGGGAGG
CAGTGAGAGGTGGTTATCTGACCCGGGCTGTCGACTTCTT
TCCGCGTGGCACCAATCAGCCACCAGTCCAGGCTCTGGTT
TACATCGCCACGCCTGACAACCCCATTTACCTGGGGCCTG
CTAGCACAGAGGAAATCGCCTCTCAGATCGCTGTGTGCAA
GGGGAATTCGGGGCACAACATCGAGTACCTGCTTCGCCTG
GCGGAGTTCATGAGAGTCAGCTGTCCTGATGTGGACGACC
CTCACCTGTTCTCCATCGAGGCAGCTCTTCTCGCCACCAT
TAGACCCATATTATTGGCCGCATAGAAACCTGTAGATCTT
CTGAAAAGCAATCAAATAGGTCAAAACAGCATTAAGGTTC
TAATATAAAGTTAATGTTGCCGTCCTTAAGGTGCGATTTG
TCATTTTAAGTGGCTGTTCAGATATTTTATTCTCCCTATA
CCAATTTATCACTGTAATACATCAGTAGGTGCTGATGTTA
CGGGAACATGGTATTTTTAGCCTGTCAACATTTGAAGTAT
GTAATGTCAAAACATGAGTACTGTCAGTTATCATTGTTTT
GTGCTCAAGTATGTTGTGCTGTGGTACAAATGCATGCTTG
TGATGTATTGCCAAATTTGTCCAGTTCTTAAGCTGTTTAT
GTTGTGAATATGTTTGCATGGAATCTCAAGACACTCCCCC
TTTTTTATTTTACAATTTGCACTAAGCAGAATACTGTTAA
GTCATTACAGTTATTTGCACATTAAAACGATCAACAAACA
TG

chac1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA chac1-002 (1) 811
mRNA chac1-201 1562
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chac1-201 Contained in:
OTHER chac1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005551 (1)
  • Ensembl_Trans:ENSDART00000103330 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK361150 (1) 799bp
    GenBank:CD778027 (1) 746bp
    GenBank:CK363278 (1) 736bp
    GenBank:CK360744 (1) 726bp
    GenBank:BE017893 (1) 516bp
    GenBank:BE017614 (1) 513bp
    GenBank:BE016516 (1) 512bp
    CITATIONS (2)