ZFIN ID: ZDB-TSCRIPT-090929-5074
Transcript Name: th2-201
Previous Name: th2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021383 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021383|OTTDARG00000017748|ZDB-GENE-050201-1 th2|OTTDARP00000018013 th2-001 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 1635 bp
CAATTTTGTTCCTCGTTTGTTTAGAGTTGGTATTGACATA
ACATTAACTGGATATATTCAGATTTTCGATGAAGTCGGAC
AGTATAGCGCAGAATGTTCCGCTGAGCGGCAGAAAGCGCA
GTCTGATTGAGGACGCGCGGCGCGACAGAGAGAGCGGCTC
TTCATCTCCGGGCCCCTCGCGCTGCGGAGACAGCTTCGTG
TTTGAGGAGGAGAAGACTGGCAAAATCACTCTCAACATCC
TCTTTGCTCTTAAAAATGAGAAAAACGCCGGCTTCTTCAA
GGCTGGCAAAGTCTTTGAGACTTTCGAAACCAAGCTGCTA
CACCTGGAAAGTCGAGCGAGCAGAAAGAGCAAGAGAAGCA
GTGGAGAAGATCTGGAGTTCTTCATGCGGTGTGAAGTGCA
CTGCTCCGACACCGACATCTTCATCAACTCTTTAAAAAGA
GTTGCAGATGACGTGCGAATAGTGCAAGAAGAAAAGACGC
CATGGTTTCCAAAGAAGATTTCTGACCTTGATACATGCAA
TCATCTGATAACAAAATATGACCCTGATCTGGACCAGGAT
CACCCTGGATTCAGTGATTCAGAATACAGAAAACGAAGAG
GATTCATTTCTGAAATGGCTTTCAATTATAAGCACGGTGA
CCCTTTACCAGTAGTGGAATACACTCCAGAAGAGAATGCC
ACATGGGAGGTTTACAGGACTCTGAGGAGCCTTTACCCCA
GTCACGCCTGCAGACAGTTTCTAGAAGCCCTCACTCAGCT
GGAGAGTGAACGTCTGTATGGAGAAGACCAGATCCCTCAG
CTCAGAGAGGTGTCTGCTTTTCTCAAAGAGAGAACAGGTT
TTCAGTTGCGGCCGGTGGCAGGACTGCTATCTGCTCGAGA
TTTTCTTGCCAGTTTAGCGTTCCGGGTTTTCCAGTGTACC
CAGTACATTCGTCACCCTTCAGCCCCCATGCATTCCCCTG
AACCAGATTGCTGCCATGAACTACTTGGACATATTCCTAT
GCTTGCAGACCAAGAGTTTGCTCAGTTTTCACAGATTGGA
CTCGTCTCGCTTGGAGCATCAGATGAGGATATTGAAAAAC
TGTCAACACTGTACTGGTTTACTGTAGAGTTTGGTCTCTG
TAAGCAAAACGGAGCAGTAAAGGCTTATGGGGCTGGACTT
CTGTCTTCCTATGGAGAACTGTTGTATGCCCTTTCTAATG
AGCCTCAGTACAAGCCATTCGACCCAGCTGAGACTGCAGT
TCAACCATACCAAGATCAGTCATATCAACCAGTTTACTTT
GTGTCCGAGAGCTTTGAGGACGCCAAACAGAAGTTGAGGC
GATATTCATCCACAATACAGACACCCTTCTCCATAAGATA
TGACCCCTACACTTGCAGCATGGAGGTTCTAGATGAGCCC
TCCAAGATCCAGAATGCTTTGGGGCAGATGAGGGATGACC
TGAAGATCTTGCATAAAGCCTTGGGGAGACTGGGACAGAA
ATAACCCAGAATGAGAGATCAGTCATCAATAACGGCTACC
TATTTAAGGAAGCCTTTTTTGTATGAATGTGAATTTTGCA
GATTATATATGAGGTCTAGGGTTGAAATGCATATGTGTGA
CTCTCAGATGTAATAAACAGTTCTATTTACGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
th2-201 Contained in:
OTHER th2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021383 (1)
  • Ensembl_Trans:ENSDART00000056002 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY620823 (1) 1635bp
    GenBank:CD598941 (1) 348bp
    CITATIONS (2)