header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5072
Transcript Name: pah-201
Previous Name: pah-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021381 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021381|OTTDARG00000017746|ZDB-GENE-031006-2 pah|OTTDARP00000018011 pah-001 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 2314 bp
AACCAGATGCGCTTTTGGTAGCAGCTTCCAAACATCCCCA
GCAGGGCTTTATGTGCACAACTGGTCGCGTGACAGGCACA
CGGGCCGGTTCAGGGGGTGTGGTGTCACGTGGTACTTTTA
AATTGCTGGATTTTTGGATGAGTTGCACTAAGTTCACAGA
AGCATCCGACAAAGCCACATCACCTGAGGACTGAAGCAAG
AATGGACGCAGGACTCACTCAGATAAACGGGGGACTGGAG
AGAAAGGGCTCTCTGACCTCATCCTACCTGGAAGAACCAA
AAAACAAATCAGGAGTGGTGTCCTGCATTTTCTCTCTGAA
GGAAGAAGTTGGAGCTCTCGTGAAAGCTCTGAAACTATTT
GAGGAGAAAGGCATTAACCTGACGCACATTGAGTCCCGTC
CATCACGCAAGAACAATGAAGAGTACGAGTTCTTCATCAG
CGTGGATCAAGCCTCCTCTAAAGTTCTGGATGAAATCGTT
GATGGTCTTCGCACCCAGATCAGGGGCCAAGTTCACGAGC
TATCCCGCAACAAACAGAAAGACACAGTCCCATGGTTCCC
CAATGACATCCAGGACTTGGACCGATTTGCCAACCAAATC
CTGAGTTATGGATCCGAGCTGGACGCAGACCATCCAGGTT
TCACTGACACCGTCTACCGGGCCAGGAGGAAGGAATTTGC
TGACATTGCTTACAACTACAGACATGGACAGCCTATTCCA
CGTGTTGAATACACAGCTGAAGAGAAGGCCACATGGGGGA
CAGTTTTCAGAGAGCTGAAGACTCTGTACCCCACACATGC
CTGCCGTGAACACAACCGTGTCTTTCCGCTGCTTGAGAAA
TACTGTGGGTATCGTGAGGACAACATCCCACAGCTGGAGG
ACATCTCACACTACCTGCAATCATGCACAGGTTTCCGTCT
GCGTCCTGTGGCCGGTCTCCTCTCCTCAAGGGACTTCTTA
GCTGGTCTGGCCTTTCGAGTGTTTCACTCGACCCAGTACA
TTCGCCACAGCTCCAAACCCATGTACACACCTGAGCCGGA
TATCTGTCATGAGCTGCTGGGTCATGTGCCGTTGTTTGCT
GACCCAAATTTTGCCCAGTTCTCTCAGGAAATTGGGCTCG
CTTCTCTGGGCGCCCCTGATGAGTTCATAGAGAAGCTGGC
TACAGTCTACTGGTTCACTGTGGAATTTGGTCTGTGCAAG
CAAGGAAATGAAGTGAAGGCTTATGGTGCAGGTCTGCTGT
CATCCTTTGGTGAACTGCAGTACTGTCTGACGAACGAGCC
TAAACTTCAGCCCTTTGAGCCAGAGAAGACCTGCCAGCAG
AAGTATCCTATTACGGAGTTCCAGCCCGTTTACTTTGTGG
CAGAAAGTTTTGAAGACGCCAAAGAGAAAGTCCGGAGATT
TGCCACTACCATCCCCAGGCCTTTCTCTGTACGCTATAAT
GCATACACACAGAGAATTGAGATGCTGGACAATGCACAAC
AGCTGAAGAACCTGGCTGACAGCATCAATGGTGAGATCTC
AATCCTGTGCAATGCCCTGCGGAAGATGTAAACAATACAA
TTTGTGAAGACTTTCGAGAGAAATCAAGAAGAAATGCTGG
AAAATCAAAGAAGCTCCACATCATCGATATTGCTTTTTAG
ACGCACCTATAACATCACTTCTAGTGTTAATCAAGCTGTT
ACAAAGAGAGCATGACATTTTAAAATAGTCATTATGTATT
GCATGTAGAAAAAGATATATATTTATAGCCTAATTTTTGT
AGTCCAAATATATAGGCGCACAAAGTATTTAACATAACGA
ATTAATACTAGAAAATACGCAAACCGAATCGCATGTAAAT
ACCAAAAAAACGCTTCGTATATTGTGTAGCGCGCTGCTTG
CAATATTTGTCATTTTATACATTGTATATTAACATGTCTT
GTTCTTGGTATTTTAGACCAATACTGACTGCCTACCGTCC
ACCATTTGCTTCAGCTTGTTGTCTCTCAGTGTTGCTGTAA
TTTTCCCAAACAACCTGCAATCAATTAAGCATCAAAGGCT
TGTTGAAATCATGAGCTGAGCCAATGCATTCGACGAGTTG
TTTTTTTATTATTATTATTATTATTTACGAGGTGTTTTAT
TTACAAGATGCGCTCATATGCCGCATTGAACTAGATGTTA
ATTACATTACTGACAAATATATGTAGCTAGTTTCGCTCGA
CTGCTTACGCAACTCAACATACTGCATATTTTGTTGTAGA
TGCAAAACTGAAATGTCATGCACGCATTGTTAAAATTGTT
TGAAAAAAAATCAATAAATGTTGACAACTGTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pah-201 Contained in:

OTHER pah-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021381 (1)
  • Ensembl_Trans:ENSDART00000011943 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC064329 (1) 2175 bp
    GenBank:BC056537 (1) 2167 bp
    GenBank:AY330224 (1) 2144 bp
    GenBank:CK869292 (1) 848 bp
    GenBank:DT074482 (1) 778 bp
    GenBank:CK235973 (1) 762 bp
    GenBank:CK027461 (1) 758 bp
    GenBank:BM184421 (1) 645 bp
    GenBank:BI473323 (1) 589 bp
    CITATIONS (2)