ZFIN ID: ZDB-TSCRIPT-090929-507
Transcript Name: vps18-201
Previous Name: vps18-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005543 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005543|OTTDARG00000005133|ZDB-GENE-020419-33 vps18|OTTDARP00000004956 vps18-001 LG_ AL929049.4 Danio rerio protein_coding KNOWN, 3544 bp
CATGATATTCATCAGCTGACCCAAGACAGACATGCAACCA
ACACAGCTCGGTTTCTCAGATCTGTCATTCCTTTTTCATT
TATAAAAATTCCCTTGGCGCGTAATTTTGTTTTATTTTAC
ACCAATAGGGTGTCCATTATGTTTTATTGAGCACGCAAAG
AGGACGTTGACAGTGACAGCTTGTGAACAGGACATTTAAC
GTTAGCTCGCATGCTAGCGTGCTATGGGTGGAAACAGCTG
GTAGGGATACTGTACATCTTTACCTGCAATGTAAACACAG
GTTCACTATTTGCTGTACATCGTCGTGTGAATATTTGATC
ATTTGCAATGGCATCTATTCTGGATCAATATGAAGATTCG
CAGAACATCCGTCAACACAGTCGTATGTCCACGGCCAACA
TCGGCATCACTCATTCAGGGTTTGTAAATGTAAGATTGGA
GGAAGAAAAACCCATTTTCACCAAGCAGCGCATCGATTTC
TCTCCTCCCGAAAAAATCAACCAATTTTCGGTTTGCAACA
ATCAGTTATGCATGAGCTTGGGAAAAGACACCCTGCTGAG
AATTGATCTCGGAAAACCTGATCAGCCAAATCAGATTGAA
TTGGGAAGAAAAGATGATAGCAAAGTACACAGACTTTTCC
TAGATCCTACAGGGTCACATTTAGTCATCTGCCTCACTAC
AAATGAATGTGTGTACCTAAATAGAAACACTCAGAAGGTC
CGAGGTCTGTCAAGGTGGAGAGGCCACTTGATTGAAAGCA
TAGGTTGGAACAAATTAATCGGCTCTGAGACCAACACTGG
CCCCATTCTGGTCGGGACCAGCCAGGGAATCATCTTTGAA
GCTGAGATCTCTGCCTCAGAGGGCAGTCTGTTCAACACCA
ACCCGGACCAGTACTTCAGACAGGTTCATTACCTCGAGGA
GGATGGCAAGCCAGCTCCGGTTTGTTGCCTGGAGGTTGAA
CGTGGTTTGGAAACTAAATACTTTATCATTGCAACCACAC
GAAAACGGCTGTTCCAGTTTGTAGGAAAGCTGGCAGAAGG
ATCTGAGCAGCAGGGCTTCAGCTCCATCTTTGCCCAGAAC
CAGGATCTTCTACCCAGCTTCCAGGAATTTCCTGTCAATA
TGGGCTATAGTGAGATTACATTTTACACATCAAAGCTGCG
TAGTCGCCCCAAGACCTTCGCCTGGATGATGGGGAATGGC
GTTTTGTACGGGCAACTGGACTATGTGCGCCCCGACTCTT
TACTCAGTGATGTTCAAGTGTGGGAATACACGCAAGACAT
TGATTTAAACTTCGTCAAACCCATCTCTATAGTCCTCACC
CAGTTCCACTTCTTGCTCCTGCTCCCTGACCGTGTCCGAG
GGATCTGCACCCTGAATGGGCAGGTTGTGCATGAAGATGT
GTTTCCCGAAAAGTTCGGTACACTACAAAAGATGATCAAA
GATCCCATAACAGGACTTGTGTGGATCTACACTGAGAAAG
CAGTGTTTCGATATCACATCCAGAAAGAAGCACGGGACGT
TTGGCAGATGTACATGAACATGAATAAGTTTGATCTGGCC
AAAGAGTACTGCAAAGATCGACCAGAATGCTTAGACATGG
TTCTCGCAAAAGAGGCAGAGCACTGCTTTCAAAACAAGCG
CTACCTAGAGAGCGCCAAATGCTATGCGCTTACTCAAAAT
TACTTTGAGGAGATTGCGCTGAAGTTCATTGAGGCCAAGC
AAGAGGAGGCCTTGAAAGAGTTTCTGATTAAAAAGCTGGT
CAATCTCAAGCCCAGTGAGAAGACTCAGATCACCCTGCTG
GTGACCTGGTTGACCGAACTCTATCTGAATCGGCTCGGTC
AACTGGAGGCCGACGAAGGCAAGCAACATTTATTTCTGGA
GACCCGTGAAGAGTTTCGTACCTTTCTTAAAAGCCCCAAA
CATAAAGATTGCTTCTACAACAATCGCAGCACCATCTACG
ACCTGCTCGCTAGTCATGGCGACGTGGACAACATGGTGTA
TTTCTCGGTCATCATGCAAGATTACGAGCGTGTCATTTCT
CATTACTGCCAGCATGACGACTACAGCGCAGCTTTAGATG
TTCTCTCCAAACACTGTGACGACAAGCTCTTCTACAAGTT
CTCCCCAGTCCTCATGCAGCACATCCCCAAAAAGGTGGTC
GATGCATGGATTCAGATGGGAAACCGGTTGGATCCGAAGA
ATCTGATCCCAGCGCTTGTGAACTACAGCCAGATGGGCAG
CATGCAGCAGATAAATGAGACCATCCGGTACATGGAGTTC
TGTGTGTATGAGCTGGACGTCAAAGAAGAGGCCATTCACA
ATTACCTACTCTCGCTTTATGCCAAACACAAGCCAGACGC
TCTGTTGTGGTACCTCGAACAAGCCGGAACTCACGTCTCC
GATATTCATTATGACTTGAAATATGCCTTGCGCCTTTGCT
CCGAACATGGATACCTGCAGGCCTGCGTCTTGGTTTACAA
GATTATGGAGCTGTATGAGGAAGCTGTGGATCTTGCTCTA
AAAGTGGATGTGGATTTGGCCAAGTCTTGCGCCGACCTTC
CAGAGGACGATGAGGAGTTAAGAAAGAAGCTGTGGCTGAA
GATCGCTCGCCATGTAGTGCAGGAGGAGAAGGATGTCAAG
AAGGCTATGAACTGCCTGTCCAGTTGCAACCTGCTTAAGA
TCGAAGACATCTTGCCTTTCTTTCCAGACTTTGTCACAAT
AGACCACTTCAAGGAGGCGATATGCAGCTCTTTGGAAGAG
TACAACAAACACATCGAAGAGCTGAAACAAGAAATGGAGG
AGGCCACAGAAAGTGCCAAACGCATCCGCGAAGACATCCA
AGAGATGAGGAACAAGTATGGTGTGGTTGAGTCTCAGGAA
AAATGCGCTACTTGTGATTTCCCCCTGCTCAACCGACCTT
TCTATCTTTTCCTGTGCGGACACATGTTCCATTATGATTG
CCTCCTGCAGGAAGTCATTCCTCACCTCTCTGTCTATAAG
CAGAATAAATTGGATGAGCTACAGAAGAAACTGGCAGCGA
CCACGCAGACCACCAAGGCTCGGCACAAGCCTAGAGAGGA
GGACACGGTCAGCTTAGGCAAAGGCCAGGGAAGCAGGGAG
CAGATCAAATCAGACATTGATGATATTATAGCGTGCGAGT
GCGTGTACTGCGGTGAGCTGATGATCAAGTCCATTGACAA
GCCGTTCATAGATCCGCAGAAGTTTGATCAAGAGATGTCC
AGCTGGCTCTGAAGGAGAGACGCATCTGCTTGAGCTGCAC
AACACATTTATTATACACATTGTACATTTGCTTAACATGT
AACCGGATGTGCATTGTAAAATTTTTACATTCTCGATTAA
TGAACATTTATATGATTTTGTCAACAAATATGCACTGTAC
AAGTGTTCTTCGTTGATTTTATGTGTTTGCTTCCTTAGAT
CAAATTTAAAAATGCACTTGTTTTCATTTTGCATAAAAGT
AATGCGAATAATATCTTTTTTATGTGCACAGCTAAGAAGA
ATAAATGATTGCCTTTTGACTGGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
vps18-201 Contained in:
OTHER vps18-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005543 (1)
  • Ensembl_Trans:ENSDART00000103352 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF506204 (1) 3553bp
    GenBank:BC086828 (1) 3542bp
    CITATIONS (2)