header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-5052
Transcript Name: csgalnact2-201
Previous Name: csgalnact2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021360 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021360|OTTDARG00000017731|ZDB-GENE-030131-5186 csgalnact2|OTTDARP00000017997 DKEY-192P21.4-001 LG_ BX005252.15 Danio rerio protein_coding NOVEL, 3015 bp
ATGCCCAGACGGGGGCTTCCTCTGCAGGGGCGGGCACGCT
GGCTTCTCCTGGGTGTTTTCCTGTTGGTGATACTGCTTCT
CTTTGCTTATCTGCTGGAGTGCACACCGCCTGCAGACGTG
AGCCAGGTGCTCCCAGGTCTGGCAGGAGATCCGTATGGAA
AAGAGTATTACCAAGCCCTCTTACAGGAGCAGGAAGAGCG
CCATCTCAGCCGAGCGGCCAGCCTGAAGAGGCAGATCGCA
CAGCTCAAACAAGAGCTCCAGGAGATGAGCGAGAAGCTGC
GGGTGCTTCAAGAGAAGAAGGAGGGTCCCGGGCCGCAGAG
TCTGAACGATGGCAGGGATCAAGAGCCAGGTGATCTCCTG
GAGTATCTGCATTCACAGATCGACAAGGCCGAGGTGAACA
CTGGAGCCAGGCTGCCCAGTGAATATGCGCTGGTTCCCTT
TGAGAGCTTCACCACCACTAAAGTGTACCAGCTGGAGATG
GGTTTGACTCGCCATCCTGAGGAGAAACCTGTGAGGAAGG
ACCGGAGGGATGAGCTGGTGGAGGTGATCGAAGCTGGTTT
GGATATTATTAATAACCCTGAGGAAGACGATGGACAGGAG
GACAACATTCCTATGCAGAGGCAGACCTTCACTGAAAGCC
AATTTTTTGAAGGGCTCTACAGGACGGAGAGGGACAAAGG
CACACTGTATGAGCTCTACTTTGCTAAAGAGAATTCTCAT
GAGTATCGTCACGTCACCCTCTTCCGGCCGTTCGGGCCCC
TCATGAAAGTGAGGAGCACGTCTGTGGACACCGCCAGTGC
CATCATTAACATCATAGTACCGCTGTCGGGACGCACTGAA
GCCTTTGTTCAGTTCTTGCATAACTTCAGGGAGGTTTGTA
TCCAGCAGGACAAGCGGGTCCATCTCACAGTGGTGTATTT
TGGGCAGGCAGGCTTGCAGGATGTGAAGGAGTCTTTGAAG
AAAATGGCCAGTGAAGAGAGCTTCAGTAACTACACTCTGA
TCCCTGTGGATGAGGAGTTTTCTCGAGGTCGTGGTCTGGA
TATTGGAGCTCATGCGTGGGAGAAAGGAGGAGATGTGTTG
ATGTTCTTCTGTGACGTTGACATCTACTTCACACTGGAGT
TTCTCAGCACCTGTCGACTCAATACAGCTCCAGGAAAGAG
GGTTTTCTATCCGGTGGTTTTCAGTTTGTATAATCCAGCT
ATAGTTTATGGAAATCTGGAGTTTCCGCCACCCATTGAGA
GTCAGCTGATTCATAAAAAAGATGCTGGGTTCTGGAGGGA
CTTTGGATTTGGCATGACTTGTCAGTATCGCTCTGATTTC
CTCAATATTGGAGGATTTGACCTGGAAGTGAAAGGTTGGG
GTGTTGAAGATGTGCACTTGTACAGGAAGTACCTGCGGAG
CGATCCGATCGTGATCCGCACCCCCGTCTCAGGCCTCTTC
CACTTGTGGCACGAGAAGCTGTGTGCTGATGAACTGACCC
CAGAGCAGTATCGCATGTGCATCCAGTCCAAGGCCATGAA
CGAGGCGTCTCACTCTCACCTTGGCATGCTGGTCTTCAGA
GAAGAGATCGAGACGCACCTGCGCAAACAGGCCTACAAAA
CCCAGAGCAGACCCGCAGAATGAAGCACATACACAAGCAA
CAGCACAGCAACAGAGAACAGTTGACTTCTTATCATTTCA
AAACAATCCATCAATTACAGAATGTTAAAGGGTTAGTTCA
CCCAACGATTTATATTGTGTTATTAATGACTCATTCCAGT
CCCCGTGAGGCCTTCGTTCATCTTCAGAACACAAATGATG
ATATTTTAGATGAAATCCTGGAGCTCTCTGACCTTCCATA
GACATCAGCAGTTCTGAGATGTTCATGGTCCAAAAGAAGA
ACTAAAAACACTCCATGTGACTTCAGGGGTTCAACTTACA
ACATACAAAGCTCCATACCTTTGTGTGTCAAAACATCTTG
TTCTTAGAGCTTTTTTGGGCAAATTTCATCTTAATTATGT
TCATTTTTTGTAAACGAAGATGAAAGAAGGTCTCGGGGGA
ATGGAATGACATGATGATGATGATGATGAGTGATTAATAC
AGAATTCTATATGTTTGGGTGAACTAACCCTTTAAGTATG
GTGGAAGGATGGTACCAATCGGTATTAATGAACTGTTTAC
ATCATTTACACTTGATCTAGGTTTTATCAAAGGCTTTTTG
GATTTATATGTGAATAACGGTCAGTTCTTTTTTGGAAGTG
AGTGATTGAAGAGAAATAATGTGGGCCACATTCATGAAAA
CTGTTTGATTTGTGCAGCTACAAGCTATCTTACTGAATAG
CTTATAAAATGTTTTCTACAAATGATTTTGCACAGAAGTT
GGTCTGCTCATTAAGATGTGCCAAGTGTGACGCATGTCTT
AGTTGTTTTTTTATGTTGAAATGACCTGATGGAGCTATAT
GTTGTGTTTTTATATTACTACTGTCGAAAGTGTTTGCGTC
GACGCAGAAAGGGAGAAGTTTTGCATACATAGATGAAAGG
GACAATCATTCACAAACTGCTCAAGCTGGATTTATGTTGG
AACAGTATTCAGACTTTTCACAAAATCTTCCTCAGTTTAT
TTGCTGATTGAATAAGCATGGAGCTGATGTGCAGTTTGAT
GCATGTGTCAGGCTTTTACTTTACACCGTGTGTGAGGACA
CTGCTCAGTGCCATACAGTTAAAGGGTTAGCTCACACCAG
AAATGAGAATTCTGTCAACTTGCTGACCCTCATTAAGATC
TAAATTTATCTTCAGAACACAGATGAAAATACATTTGAAT
CGAATCTAAGATATTTTTTGTCAGTTTTGAAAGCCTGATG
CTTTGTAATGAGCCAATTCTACTAATCTAAATCTGCTGAA
AAAGATTCAATGGAAAGTTTTGGCTTTTATTCAAGTTAAC
AATCGGCAAACTTAACCAAACTCAATCAGTCACTTGAGCA
AGGACAAACCTTGTTGATTCTTGCAGAAGTTCACACGTGA
AGAAAGAACCTCATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
csgalnact2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000021360 (1),  Ensembl_Trans:ENSDART00000087533 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK398207 (1) 781 bp
GenBank:BI890041 (1) 685 bp
GenBank:AI588699 (1) 546 bp
GenBank:BU744178 (1) 539 bp
GenBank:AI794172 (1) 529 bp
GenBank:AI878205 (1) 504 bp
CITATIONS (2)