ZFIN ID: ZDB-TSCRIPT-090929-5
Transcript Name: gpr161-202
Previous Name: gpr161-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000001380 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000001380|OTTDARG00000001280|ZDB-GENE-030616-58 gpr161|OTTDARP00000001218 RP71-20I5.4-001 LG_ AL590146.2 Danio rerio protein_coding NOVEL, 1702 bp
ATGAACGGCTCTAAGAATGGGACGGCGGTGGCCAACTCCA
CTAATGGCCTGGATGACAACGGGCTCATGGTCCTGGAGTC
TGTCTCTATCATCATCATAGCCATACTGGCATGTCTGGGG
AATCTGGTCATTGTGGTGACTCTTTATAAAAAGCCCTACT
TGCTAACACCCAGCAACAAGTTTGTCTTCAGCCTGACTTC
ATCCAATTTGCTATTATCAGTTCTAATGCTGCCGTTTGTT
GTGGCCAGTTCGGTGCGTCGGGATTGGATGTTTGGGGTGG
TGTGGTGCAATTTCACAGCGCTGCTCCATCTACTTGTCAG
CTCATCTAGCATGCTTACACTTGGAGCCATTGCCATTGAC
AGGTACTATGCAGTATTATACCCCATGATCTACCCCATGA
AAATCACCGGAAATCGAGCTGTGCTTGCAATCGTTTACAT
CTGGCTCCATTCCCTAGTTGGCTGCCTGCCGCCTCTTTTC
GGATGGTCATCGTTTGAGTTTGACCGCTTCAAATGGACCT
GCACGGTGTCCTGGCACAAGGAGATCAGCTATACTGCCTT
TTGGGTTACATGGTGTTGCCTTTTGCCGCTGGTGGCCATG
TTGGTCTGCTACGGAGTAATTTTCCGCGTAGCTCGCATCA
AAGCTCGTAAGGTTTATTGCGGCAGTGTTGTGGTGTCTCA
AGAAGAGTCCAGCTCTCAAAATAATGGCCGCAAAAACTCC
AACACCTCAACATCTTCTAGTGGCAGCCGCAAAAGCCTGA
TTTACTCTGGGAGCCAATGCAAGGCCTTCATCACCATTTT
AGTGGTTCTGGGGACATTTCTGACCACTTGGGGTCCTTAT
GTGGTTGTTATCAGCACCGAAGCACTATTAGGGAAAAATA
GTGTTTCTCCACAAGTTGAGACGCTGGTTTCTTGGCTGTC
TTTTACCAGTGCTGTGTGTCATCCACTTATTTATGGGCTG
TGGAACAAGACTGTACGCAAGGAGCTGTTGGGGATGTGTT
TTGACGATCGGTACTACAGAGAGTCATTTGTTATACGGCA
CCGGACCTCTCGTCTGTTTAGCATCTCAAACCGGATAACA
GATTTAGGGATGTCTCCTCATCTGACGGCCATGTTGGTTG
GTGGAGGTCAGCTTTTGGGCCGTGGAAGCAGCACTGGAGA
CACTGGCTTCAGCTACACACAAGACTCAGCAACAGACGTC
ATGCTGTTGGAGAGCTACACCTCAGAGGCGTCCCACTCAG
CCCACTGCACCGCCAATAAGAGGAGGAGCTCGGTCACATT
CGAGGACCAAGTGGATCACATACCACAAGGTGACCCTTCA
GTAGTCCAAGTGACGGCAGACATCCACAAATCTTTGGACA
GTTTTGCATCCTCTCTGGCCAAGGCTATAGAGAACGACGC
CAAGCTTCAGCTCTTAGGAGAATGGACACAAATTCCCACA
AGTCTGTTCACAGTTCGAAACACACAGCGAGTGCCTCGGT
ATCTGGACGGACAGAGACTCAGGATGGAAAGCATCGATGA
AGGAATAGTCAAAGATGATGATGATGATGAAGAAGAAATG
GAGCGCGAGGAAAAAATGTAGTTCTTTCGACTGTGAACTT
CTTCAAGGATCAGATTGTTATTTAATCTGCAGCTTTTGAA
GGTACAGAATGTTATACAAACACATTGGCACATGTTTACA
GATAAGACTGGCATACTATGTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gpr161-202 Contained in:
OTHER gpr161-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000001380 (1)
  • Ensembl_Trans:ENSDART00000143991 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)