header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4984
Transcript Name: hoxd3a-203
Previous Name: hoxd3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021043 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021043|OTTDARG00000017440|ZDB-GENE-990415-120 hoxd3a|OTTDARP00000017733 hoxd3a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 1970 bp
GTCAATGCAATCTTTACTAAAACTGGCTTATTTTCTTAGC
AGGTCAAAGGACAGAAAATCTGTGGGAAGCTCCAATCACG
TGATTCACAAGTCCATGCTATTGGACAGGAGTTCACAGGA
TCTCTAAGTTTGAACCTTCGCAATGCAGAAAGCCACTTAT
TATGACAATGCTGGACTTTTCGGAGGATATTCGTACCCTA
AATCTGACTCCTACACGTACGGTCCAACACACCAGGGCTT
CTCATCCTCCAGTATAGAGAATGACTATCAAAGCCCAATT
TGTCCAATTCAAACTACATCAGTCCGGCAAGCAACCCATA
AAAACGGAGACATCAATGGCAGTTGTATGCGACCAAGTGC
CAGTCAGGGCAACAGTCAGCCAGAGAGTATCAGTGAGCAG
CAGCAGGCTGCTCCATTAGCGGCCAGCTCTCCCAGCCCCA
GCACTAACTCCACACAAAAAAAGAAATCCCCCAGCTCTAA
TGGATCCAGCACTGCCACCCCAGTCATCTCCAAGCAAATT
TTCCCCTGGATGAAAGAGACCCGCCAAAATGCAAAGCAGA
AAAGCACCAACTGCCCAGCAGCAGGAGAAACCTGCGATGA
CAAGAGTCCGCCTGGCCCTGCGTCGAAACGAGTGCGCACT
GCCTACACCAGCGCCCAGCTAGTCGAGCTGGAGAAGGAGT
TTCATTTCAACCGCTACCTGTGTCGCCCCAGAAGAGTGGA
GATGGCCAATCTGCTCAACCTCACCGAGCGCCAAATAAAG
ATCTGGTTTCAAAACAGAAGGATGAAGTACAAAAAAGATC
AGAAATCTAAAGGCATAATGCACTCTCCCTTAGGACACTC
TCCGGACAGGAGCCCGCCGTTAAGTGGCTCGAATCACATT
GGATATTCTGGTCAGCTTCCGAACGTAAACAGCCTCAGCT
ACGACGCGCCGTCGCCTCCGTCATTCGCCAAGCCGCAGCA
GAATATATACGGCTTGGCGGCATACACGGCGCCATTGGGC
GGCTGCATACCGCAGCAGAAAAGGTACCCGGGAACAGAGT
ACGACCACCACAGCATGCAGGGGAACGGTAGCTTTGCTAA
TGCTAATTTACAAAGTAGCCCCGTGTACGTCGGGGGAAAC
TTCGTTGATTCAATGCCAGCCTCCGGCCCCATGTTCAACC
TCGGTCATCTTCCCCATCCCTCATCCGCTAGTGTGGACTA
CAGCTGTGCCGCTCAGATTCCGGGTAACCACCACCACGGA
CCGTGTGACCCCCACCCCACATACACAGACCTCAGCTCTC
ATCATGCGTCTCAGGGAAGGCTGCAGGATGCGCCCAAACT
CACGCACCTGTAAGGATCCCATCTGTGTGCTCAAGCGAAG
GGTCGCTTTTTGTATTACCTCACTAGCTAAACTAATTTAT
AAAAACTACACTCGGAGAGAAACATAACGTATTATCCTGT
ATTATTATTGATATTACTATTACTGCTATGATTGTAATTA
TTTTTTAATAATAATAGCTGTGGTCCATTTCTCTTTGACT
GTTGAAGACACACACAAGGTTGTTTGTTGCCGGGTTCTCC
AAAGAACCGAATCGGCAATAATGAGGGCAATTTCCATGAC
GTATTATACTTGAAGGTAAGTTCTGTAGATTTGACCGTAT
AGACATTCGTCTTTATAGAGGTGGGTTTTTGTAGAGGATT
AAAAACCATCGCGTCGTCTGTTACTCACGGGTTTTTCGCC
ATACCATTATTTATTTTCCACCAAGATTGTATGACAAGCA
TTTATAATGACTGAGTATTATATTTATTATTTATCGTTTT
AATTAACGCACATTATTTATATTCTCATGTATATTATTTA
TATAGCAGGTGTAGAATTTATTTTGGAGCAGAAGGCATTT
CTTTGAACTGGTGCAAACAAGGTAATAATGTGAGATTGGT
GTATTCCCTTCTTCATTCAGTAATAAAATATTGTGAAAAT
GAAGAACTAA

hoxd3a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA hoxd3a-203 1970
ncRNA hoxd3a-002 (1) 480
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxd3a-203 Contained in:
[BAC] RP71-78H1 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000021043 (1),  Ensembl_Trans:ENSDART00000146131 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC091677 (1) 800 bp
GenBank:CK682192 (1) 671 bp
CITATIONS (2)