ZFIN ID: ZDB-TSCRIPT-090929-4982
Transcript Name: hoxd4a-201
Previous Name: hoxd4a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021041 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021041|OTTDARG00000017438|ZDB-GENE-980526-214 hoxd4a|OTTDARP00000017731 hoxd4a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 2288 bp
AATATTAATTTACAAAAAATGTTATACACTCACACACACA
TGCTTGGTTATGTGGCATGAGAACATGTTTTTATGATAGC
ATCTAATGTGTAAATAGAGATCCTCCCATATGATGATGAA
CAATTGGCTATTGCATGAGTCCCAGCACTGCTTTCCTCCT
TGTCTCTTTCTTTTATATGGGTATTTAATCAATAAAATTT
TATATTGTGTTATTTCCATCCTAATTGAGAGATAATGTGA
AGTTTGTAAAAATCACTACTAGGTGTGCACAGCTTCTTCT
CGGTTGATGAAGTCCCTCCACCTCGATTGGCCAAGCTGGT
CACATGGTAGGCTAACTTTATTCAGTTGACAGCAAGTAGG
AGGGCTTTATGGAGGGAGGAAAAAAAGACAACTCGAGAAA
AATTAGTATTTCCTACCTTCAGAAATTAATGGCCATGAGT
TCGTACATGGTGAACTCCAAGTATGTGGATCCCAAATTTC
CTCCTTGCGAGGAATATTCTCAGAACAGCTATATACCTGA
ACAGAGCCCAGGCTACTACAGTCCGTCGCAGGACACTGAT
TTCCAGCATCCCGGAATCTATTCACGGTCAAACTACTCTG
AACAGCCTTACAGTTGTAGCACTGTCCAGGGCTCGTCGGT
GCAGCCGCGGGGTCATGTGCAGGATCAAGCCAGCACCCCT
AGCCCTTTCCCTGCACAGACAGAGCAGTGTCCCGCGGTCC
AGATTTCCGGATCGAGGACTGGTGGACAACAACAAAACAC
AAAGACCCAGAACGGGATACCAACGAAGCAGCCTGCTGTA
GTTTACCCGTGGATGAAGAAAGTGCACGTTACTACGGTGA
ACCCGGATTACACAGGACCTGAACCCAAACGTTCTCGGAC
AGCCTACACAAGACAGCAGGTTCTCGAACTAGAGAAGGAG
TTTCATTTTAACAGGTATCTAACAAGACGGCGTCGCATCG
AGATCGCGCACACACTCTGTCTTTCTGAAAGACAGATTAA
AATCTGGTTTCAGAACAGGAGAATGAAATGGAAAAAGGAT
CACAAACTACCAAACACGAAAGGAAGATCGGCATCAGTTG
GAAATCAGCATGCACAACACGCTCAGAAGGACAGCCAGAC
AGAGATCACAACTTTATAAGTGGATATCTCTCCCTCCCTT
CAGATGTACAGATGAACTGTATGTAATAGACAATGCTTAA
TTTGACATTGCATGGTAGAAAATCATGACATGTTGGGTCT
AAGTGCCAAAAACTGAGAAGCTGAAGCACACACCATGACT
TAATGCAGCGTAAAAGCTGCTTTGCGTTACAATTCCCAAT
ATTTCAAATATTGTAACCCTTTGTATGAGAGGCAAAGAGG
ATATGAGGCATCGAATGATGGTTCACAAATCACCACGAGG
TACAGTAAAACGTCATAAAGCTTACGATTTTACACAAACT
TGCCAAATTTATTTGAGAGCATGGTCTTTTAGTGATCCAA
TTCAATTCGTTATTTTGGAAAATCTCTGTATTTTAATCAC
AAATGTCCTTTTTTAAAGAAATTATGGCAGGTTTATGCCT
GTGGCGCGCCAGTTTATCTTAACTTAATCGTTAGACAGAA
CTTAAGCAAGGCAATACCCCCCGTATAATTAACTATGAAT
GTTTACCGCTTTTTTTGCATTAAAGTCGACTGGGTGCAAA
TAATATAATAAAAAAATAAAATGAGTTTAATAGTAGAAAA
AATATCCTTGCCTGGTGAAATTATTTATTCGTGAACTGAA
AGGTGAACAAAAATATCCCCGAAGCCCTCTTTCTGTGCGC
GCCTCGTTTGCTTACTTTAAGACTATTTCAGTCTTTAATT
TTTAACTTGTGTATATTTTATTAAAAATTCGTTGCAGATG
ATTCTCAGTTGTTTACTGCAGCCTCTTGTCCTATTTAATT
CAATAAGAAAATATCTTTTTTAACACGAATATTCCTTGCC
TTACACTCCACTATAAATCCCGCTCGGCATCTTTGTAAAC
AAATAGCTACGACTAAAGTAGCAATCTATCCGTCTTCCAA
ATGTTGCCTGAAGTTCTTGAAAAGCAGCTTTTTATTTAGC
ATTTTAGACACACGTTTAGCCCTCCAGATGTTTGAACCTT
CTATTTATTAAATATAATGTTAAAAGCTTTATGTTGTGAA
CGTAATTATCCGTTCCATAATTATCAAATTCCGTTTTTAA
GTTCTTATATATGTATATATTTCTGTATATTGTGCATATT
TTCTACAGGCATATTTTGCAGTAATTAAATAAATATATGC
AGAGGTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxd4a-201 Contained in:
OTHER hoxd4a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021041 (1)
  • Ensembl_Trans:ENSDART00000082355 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162966 (1) 1247bp
    GenBank:BC162983 (1) 1238bp
    GenBank:CK692919 (1) 817bp
    GenBank:AL714210 (1) 743bp
    GenBank:AL730827 (1) 722bp
    GenBank:AL725211 (1) 703bp
    GenBank:CD285400 (1) 668bp
    GenBank:AL714244 (1) 640bp
    CITATIONS (2)