header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4979
Transcript Name: hoxd9a-201
Previous Name: hoxd9a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000021038 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000021038|OTTDARG00000017435|ZDB-GENE-990415-121 hoxd9a|OTTDARP00000017728 hoxd9a-001 LG_ BX322661.17 Danio rerio protein_coding KNOWN, 1407 bp
GAAGGTGAAGGCAGCAAAAATACTACGATTGTTCGGAGGC
AAGGTTTCGGAAACAGAGTACCGTTTTATATGAGTTCGAA
GGGATCCAAAAATGTCGACTAGTTCAGCTCTCAGCAGTTA
TTATGTGGACACTATTATGGGGCACGAGGCTGAGGATGTG
TACGGAGCGCGTTATATCCAGGGTTCTCACACCGCGCCCG
CGAGGCCGTCAGGTGTGGTTGAAAATGCGGACTTTTCCTC
GTGCAGCTTCGCTCCCAAATCAGCCGTGTTCCCTGCGTCC
TGGTCCTCGGTTCATCAGCCATCTACTGCTGCTGTGTCCG
GGATTTACCATCCATACGTTCACCAGACCCATCTTTCAGA
CAACAGATACGTCCGATCCTGGATAGAGCCAGTCGCAAAC
CATATCTCTTTAACGGGCTTCCACCCCAACAGTCGGCACA
GCGGTACAAAGACTGAAAGTTTACCCCCGAAAAGGACCGA
AAGCGCCGCGTTTGAAACGGAGACACCGTCGGTTCCCGAG
TTTAGCTTAAATGCTGTGTCCGAGAGCGCGGACAAAGCTA
CCGAAGAAAGAGTTGGAAGTGATAATTCGAGTCACGGTGA
GCCTAAAGACGAAAAACAACAACAACAACTTGACCCAAGC
AACCCTGCTGCCAACTGGATCCATGCGAGATCAACAAGAA
AGAAGCGTTGTCCGTACACCAAATATCAGACTCTGGAATT
GGAAAAGGAGTTTCTTTATAACATGTATTTAACGAGGGAT
CGTCGCTATGAAGTTGCACGAATCCTGAATTTAACAGAGC
GCCAGGTGAAAATCTGGTTTCAGAACAGAAGAATGAAAAT
GAAGAAGATGAACCGAGAGAGGAGCAGCAAAGATCCGTAA
TGGAAAGCGTGCAAGAAGCTAATGCGCGTTTCTTTAGCAC
GCTTGGTTTAGGATACAAGTTTTGTCCATTTTTTGTTTTA
GTCACTCAAGATTAAATTGGCGTATATTCTATTTAATTTG
ATATATTTTTAAATATATATATTTTTTCCTCAGATAATAA
TTAGTATTTGAGTAACTTTAAATAAAAGGGTATTTCAATC
CTCCTAAATTGTATTTCCCAGGTCTGAGCATTTCTTATTT
TGCACAGTGTCAGCATACTCATACTCATTTAAATATCTTG
CAAGTAATTAGGACATCTGCTAGTTCTTAATCTGATGATC
TGATGAGATTTAAATATTTGTCCACAATGCATGCAAATAG
CCTACCTTCCATCTTCATACAGCCACATGTAGTCATTTAC
TGTGCCATTAATTTTACTTTTTCCTTTTTTTAATTGGACC
TTTTGTACAGTCTCATTTTGATTCTAGTGTATTTCTCGTT
GAAACTGTTGTCGCATCGAAAAGGTCTAAATTATAAACTA
AAACGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hoxd9a-201 Contained in:
OTHER hoxd9a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000021038 (1)
  • Ensembl_Trans:ENSDART00000082354 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056695 (1) 1410bp
    GenBank:CA474929 (1) 892bp
    GenBank:CN327894 (1) 865bp
    GenBank:CK696583 (1) 725bp
    GenBank:CK675901 (1) 459bp
    CITATIONS (2)