ZFIN ID: ZDB-TSCRIPT-090929-4827
Transcript Name: gmnn-202
Previous Name: gmnn-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020630 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020630|OTTDARG00000017117|ZDB-GENE-030429-30 gmnn|OTTDARP00000017427 gmnn-002 LG_ BX957279.13 Danio rerio protein_coding KNOWN, 786 bp
AACTATTACTGAATTACTGAAATATAACTTTCCAGGTGCA
AGTATGAGTTCCATCAGAAGACCAAAGAATGCAGAAAACC
CGTCTGAAAACATCAAGAAATTCCTGGTAGCGCCAACATC
TGGAGCAGGAATGGGGAGGAGGACGCTTCAGGTGCTTCAG
CCCTCCGCTGTAAACAAAAACCTCGGTCGTATAATTGAGA
ATGGTAAAGCAGTGGCCAAAAGGAAGATGTGGAGCGCCGA
GCAAGTGAAGGGTTCAAAGAGAGTCAAAGCAGAGGTGGCT
GTCAAATCCACAAATGCAGAAAATGAAAACCAGCCTGAGG
GGGTCACACAAGAGGCCTATGAGCTCATGATCAAAGAAAC
TCCTGGTTCCTCCTATTGGAAGGAGGTGGCAGAGGAAAGG
AGGAAAGCCTTGTTCAGTGTTCTCCAGGAGAATGAAAAGT
TGCATAAAGACATTGAAGCCAAAGACGAACAGATTGCTCA
GCTGAAGACTGAGAATGAAGAGTTGCAGGAACTGGCGCAG
CATGTACAACACATGGCAGACATGATCGAAAGATTAACTG
GAAAAAGTCCAGACAATCTAGAAGAGTTGCGTGAGATTGC
CTTTGATGCTGAAGATGAGGAGTTGGAGAATGAAAATGAA
GATGAGGAAGAACATGAAGATGAGGATCAGGAGCATGACT
GTGAGGGTGAAGCTGATGAAAGTCAAGACACTGAAGAAAA
CCCAGAATGGTCTATAAAACACAACGATTCTGCAACAGAA
GAAAGCTGACATGAGTAGGTGAACTG

gmnn TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gmnn-004 (1) 818
mRNA gmnn-201 (1) 1031
gmnn-202 786
aberrant processed transcript gmnn-204 (1) 808
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gmnn-202 Contained in:
OTHER gmnn-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000020630 (1)
  • Ensembl_Trans:ENSDART00000132182 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN017712 (1) 884bp
    CITATIONS (2)