header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4826
Transcript Name: gmnn-201
Previous Name: gmnn-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020629 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020629|OTTDARG00000017117|ZDB-GENE-030429-30 gmnn|OTTDARP00000017426 gmnn-001 LG_ BX957279.13 Danio rerio protein_coding KNOWN, 1031 bp
CTTTACACACAAACTAGTGCTGCTCTGTGTATGTTTTTGT
GAAGCGAGCGATTGTATTCTGAATTAAGTGCAAGTATGAG
TTCCATCAGAAGACCAAAGAATGCAGAAAACCCGTCTGAA
AACATCAAGAAATTCCTGGTAGCGCCAACATCTGGAGCAG
GAATGGGGAGGAGGACGCTTCAGGTGCTTCAGCCCTCCGC
TGTAAACAAAAACCTCGGTCGTATAATTGAGAATGGTAAA
GCAGTGGCCAAAAGGAAGATGTGGAGCGCCGAGCAAGTGA
AGGGTTCAAAGAGAGTCAAAGCAGAGGTGGCTGTCAAATC
CACAAATGCAGAAAATGAAAACCAGCCTGAGGGGGTCACA
CAAGAGGCCTATGAGCTCATGATCAAAGAAACTCCTGGTT
CCTCCTATTGGAAGGAGGTGGCAGAGGAAAGGAGGAAAGC
CTTGTTCAGTGTTCTCCAGGAGAATGAAAAGTTGCATAAA
GACATTGAAGCCAAAGACGAACAGATTGCTCAGCTGAAGA
CTGAGAATGAAGAGTTGCAGGAACTGGCGCAGCATGTACA
ACACATGGCAGACATGATCGAAAGATTAACTGGAAAAAGT
CCAGACAATCTAGAAGAGTTGCGTGAGATTGCCTTTGATG
CTGAAGATGAGGAGTTGGAGAATGAAAATGAAGATGAGGA
AGAACATGAAGATGAGGATCAGGAGCATGACTGTGAGGGT
GAAGCTGATGAAAGTCAAGACACTGAAGAAAACCCAGAAT
GGTCTATAAAACACAACGATTCTGCAACAGAAGAAAGCTG
ACATGAGTAGGTGAACTGAAAACCGCCTTGATGGACCAGT
TGTTTGGTCTGAAGTGATGAATGTTTAACTTTTTGCCTTT
CAGAACTAATGTGCACCTTTTTTATTTTAATACTTTTTCT
TTTGCTGTAAATGAGCTTTTATTTTCACTATCTGTAGTTG
TGCATGTATACTGCCAGTGTACATATGTAAACTTGAGTGC
ATATGATGGAAATAAACGCCGGTTTTGTACA

gmnn TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA gmnn-004 (1) 818
mRNA gmnn-201 1031
gmnn-202 (1) 786
aberrant processed transcript gmnn-204 (1) 808
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gmnn-201 Contained in:

OTHER gmnn-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000020629 (1)
  • Ensembl_Trans:ENSDART00000052185 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC055552 (1) 1106 bp
    GenBank:BC049069 (1) 1046 bp
    GenBank:CN838791 (1) 806 bp
    GenBank:DN600540 (1) 791 bp
    GenBank:BM534037 (1) 624 bp
    GenBank:AL731174 (1) 597 bp
    GenBank:CB417247 (1) 572 bp
    GenBank:AL731121 (1) 475 bp
    GenBank:CK713295 (1) 327 bp
    CITATIONS (2)