ZFIN ID: ZDB-TSCRIPT-090929-4550
Transcript Name: nfe2-201
Previous Name: nfe2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019715 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019715|OTTDARG00000016404|ZDB-GENE-030124-1 nfe2|OTTDARP00000016655 nfe2-001 LG_ BX571773.12 Danio rerio protein_coding KNOWN, 1640 bp
GACATTTGGAGCACATGGGAAGGGAAACACCAAACTGTTT
TAAAGGAGATATATTTTTACAGAATAAGCCACGGAGTGAT
ATCATCTTCGATTTATGGGTGTGTGGATGGAAAGTAGTTA
AGTTACACTAAAGATTGCTGGCCTGCTGACCACAGATGAA
CTATATTAGTGGTTATAGTGATTCAGTGCAGCAGGGGTTT
GTCCTGAATGTGTTCAGCAGTCAGCGGTGTACTTCCCCTG
AGGATCAGCTGTGAGGGACTGCCAAACCCTGGACGACTGC
ATGGGGAGGTATCAATGTCCACCAATGTCACTGGATTACG
GACACATCGTTCCCCCCAGAATTTGGAGATGGACTTGGCC
TGGCAGGAACTAATGGCCATCACAGAACTTCAGGAGTTTG
AGGAACCCAATGAGAATCCTTTCGAAGCAATTCCATACCT
CTCCATGGAGCCCATGGTATCTCAAGGGGGGTTCGGGATG
AATCAGCCACAGCCTGAATCCATTCCAGCCACTTGTGATG
CCCATCCTTCTGGTGTATATGAAAGCGCATACCCGGAAAT
GATGCCACCCTATCCACACATGGATATGCACTACGGTCTT
GCTGGTGGCCACGGTTCTTCCAGAATGCTTGCAAATACAC
AAGGTTTTCACCCACCTCTTATGAGCCTTTTGGAGCACAT
GAACATGACTACACGTGGTCATGGGATTGTGAAAGATGGT
ATTATTAATTTTCACTCTACAGGACAAATCAAACAAGTTT
GTACAGATGATCTGGAGTCAGATTCTGGTTTGTCGCTTGG
TTCGAGTCCGCCGCTCGCTTCTCCTGAGAACGCAGTACAT
GGAGTTCCTGCATATTTGCCTACTGATATTTCTACAGGCT
ATGCTGAAAGTGAAAGTATTGGGGAACAATGTCGCCTACG
ACCTAATCTGCATGGGGCTGTTGACTACCAGCAGTCATAC
AGCTCATATCCTGGAGCTTCTTTTCCAACATCTGCAAACA
TGCCATCTAGCAACCTGCACACTTACAGTCCGGTGGCATC
AATAAAGCAACCAGTTTTGCCCACAGCCTTGGATGATCTA
CAGCTAAATAGCTCAAGAGTAGGTTCATATCAGTCCCCAT
ACCCAAAGTGTAAATCCAGCAGTGTTCCTGTACCCCTCAG
CAGAGATGAACGGCGAGCCCTCGCTCTTAAAATCCCATTC
TCACTGGAAAAGATTGTGAACCTACCAGTGGATGACTTCA
ATGAGCTCTTGACCCAATTCACACTGAACGATGCTCAGCT
GGCACTTGTAAGGGATATTCGCAGAAGAGGAAAGAACAAA
GTTGCGGCTCAGAACTGTCGTAAACGGAAGTTGGAGAATA
TTGTGCATTTAGAAAGTGAGCTGGGACAGCTCCGAGCCCA
AAGAGAACATTTAGCCAGAGAGAGACTGGAGTTTCAGCAA
AACATAGCCATCATCAAATGTCGGCTCTCAGATCTTCACA
CCCAAGTGTTTTCCCAGCTGCATGATGAGGAGGGACATCC
ATATTCAGTTGATGAATATTCACTACAGCAAACGAATGAT
GGCAACATTTACTTCGTGCCACGGAATGCAGCACTGGCTG
GTGAATGAATGTTTGATTAAAGTGATAGTTCACCCAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nfe2-201 Contained in:
OTHER nfe2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019715 (1)
  • Ensembl_Trans:ENSDART00000014840 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY170917 (1) 1331bp
    GenBank:CD586518 (1) 322bp
    CITATIONS (2)