header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4512
Transcript Name: sync-202
Previous Names: sync-001, si:dkeyp-25a3.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019590|OTTDARG00000016320|ZDB-GENE-060503-747 sync|OTTDARP00000016568 DKEYP-25A3.7-001 LG_ BX465206.15 Danio rerio protein_coding NOVEL, 807 bp
AGCTCTTCAGTTTGGGTTCATTCCATGGTTATTGTCCTGG
AACCTTGTTTTCTGGGTTGAGCTTGTAGGGCAACACGTAA
TATGGAGGATCAAGAAATGAACTGTGAGAAAGGAAATGGG
GCTCTATCAGAGACGGAGAGAAAGTTTGAACCATTGTTTA
TTGAAGAAGAAGATGAGGACTATTTTGAAGACTGCATGGA
AGAGATCGAGGCTGCTTTAACTCTTCCTGGAGAGTCCCTG
CCTTTTTCACAAAAATGCAGAGAAGCTTTGCAATCTAAGT
TTAATGGACTTATGCAACAGATGTTGATGCAGTTGGATGA
TTTTGAGGCAGCCCATCCAACCATATCTACACCACTGGAA
TTACTTTCAGAAACAGACAACAAAATGGACAAGAATGGAT
TTCCAAATGCATTTCAGTTTGTCGAGATGAGCATTCCAGA
GAAAGAGCCATCTGTTTTGGTGGTTGAAGATGATCCTGTA
TACACTTGTGTTTATGTAAGGCCAGAGTTTTCAGCCACCA
TGGAGATACAACAGCTTAGAGAAGCATTTGAGAGCTGCAT
TCAGGAGGTGAGCCAGCTGGAGAACAGAAGGGATGAGTTG
GTTCAGGAGCTTTTGGAGCTTGAGGAGCCAATGGCCCAAG
AGCTAAAAACTGTGAGAGAAAATCTGGGGGAGGAACAAGC
CCTTCTGTCCAAGGTCAGACTGGAGAGACAGAGCCTGCAG
GAGGAGACTCAAAAGACTAAAAGACGCCTGTTTAGAGCAG
CCCGAGACTGTGCACAGAGACACCTAGAGCTTGAATTACA
ACAGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sync-202 Contained in:
[BAC] DKEYP-25A3 (1)
OTHER sync-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019590 (1)
  • Ensembl_Trans:ENSDART00000134645 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN502058 (1) 810bp
    GenBank:CF999645 (1) 769bp
    CITATIONS (2)