Transcript

pdha1a-201

ID
ZDB-TSCRIPT-090929-4455
Name
pdha1a-201
Previous Names
  • pdha1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000019468 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000019468|OTTDARG00000016233|ZDB-GENE-040426-2719 pdha1a|OTTDARP00000016473 CH211-114C12.11-001 LG_ AL928875.4 Danio rerio protein_coding KNOWN, 2349 bp
AGAGGGCAGTATTTCCAGAGGAATGCACGGCGAATCTGCA
GCAGCTGTAAACCTCGCTAGCTGGGCTGGTTCTGTGAGTG
GACCGAAGGAGATCACTTTTCTGGTTAGCTGTGGGTTAAT
AGCATGAGAAAGATGCTAACCATAATTTCTAACGTTCTGA
GGGGCGGCGCCAGCAGGAACGGTGCCAGGATTGTGGTATC
TGCCAGGACATATGCAGACTTTACCCCTCAGGCCACCTTT
GATATTAAGAAATGTGACGTGCACAAGCTGGAAGAGGGCC
CAGCAGTGCAGGCAGTGCTAACCAGAGAAGAAGGCCTTCA
ATACTACCGAACAATGCAGACCATGAGGCGCATGGAGCTC
AAAGCTGATCAGCTGTACAAGCAGAAGATCATCAGGGGCT
TCTGTCACCTTTATGATGGACAGGAAGCGTGTGCCGTGGG
TATTGAGGCGGGTATTAATCTATCAGATCATCTCATCACA
GCCTACCGTGCCCACGGGTACACACTCACCAGAGGAGGCA
CCGTTCGGGAGATCATGGCTGAGCTGACTGGTCGTAGAGG
AGGTATTGCCAAAGGAAAGGGAGGGTCAATGCACATGTAC
ACTAAACATTTCTATGGAGGAAATGGAATTGTGGGAGCTC
AGGTGCCTCTTGGGGCGGGTGTAGCGTTGGCCTGCAAATA
CCAGGGCAAGAATGAGCTGTGTGTTTGTCTCTATGGTGAT
GGTGCTGCTAATCAGGGTCAGATCTTTGAAACGTATAATA
TGGCATCTCTGTGGAAGCTGCCGTGCATCTTCATTTGTGA
GAACAACAAATACGGCATGGGTACTTCTGTGGAGAGAGCG
GCCGCTAGTACTGACTACTACAAAAGAGGCGATTTTATCC
CTGGATTGAGGGTGGATGGCATGGATGTTCTTTGTGTGAG
GGAGGCCACCAAATTTGCTGCTGAACACTGCAGATCAGGA
AAGGGTCCTATTCTGATGGAACTGCAGACCTATCGTTATC
ATGGACACAGTATGAGCGACCCAGGAGTCAGCTACCGCAC
ACGTGAGGAGATCCAGGAGGTGCGCAGCAAGAGCGACCCT
ATCTCGTTGCTGAAGGATCGCATGCTGAGCAACAACATGG
CCAGTGTGGAGGAACTGAAGGAGATTGATGTGGAGGTAAG
GAAAGAGATTGAAGACGCAGCTCAGTTTGCCACCACAGAC
CCTGAGCCTCCGCTGGAGGATCTTTGCAACCACATTTTCT
ACAATGACCCTCCTTTGGAAGTGCGTGGCACCAACCCCTG
GTCCAAACTCAAGTCCATCAGCTAAATCTCCTTCATCCTC
CTCTTCCTACTGGTTGGACCCTCTCCTATTAAAACGCACA
GATAAAAATCCTCCCCAGTGTGGCTATAGGTTTCAGAGAC
AGTTATTGGGGAAACTCAGCCAAATCTCCCAGCCACATTG
AGAAAAGTTGCCTCATTTCACATTTGATCATTGCCTTGTT
TTCTTGTCTTCATCAGTTACAACACTAACCCTCAATTTAT
TTTACATCATCTATTGCAAAGAGCATGTACAGTAATATGT
GAATAAACACGGCAGGACTTGGCTTGTAATTATTGGTACT
TTCCAAATGTTTCCAGTACCTCTACAACATCCACACAATG
GCAGAATATTTACTTTGTCCACTCAGACATGCATGCGCTC
ACACATTCACAGCTTTATATATCCGCAGAAGTGTGTGTGT
GTGTGCTTATGTGTGTTTTAGCCAAGGTGTTGGTGAAACG
CAGCCTTGCAGTTTTAGCTTTACAAAACATTTAAAGGGAA
GTGTTTATTAACAGTTAAAATGTAAATCATTGTGGCCATA
CTACAGGAAAAGTTTGTGTTTTTTTGTGGTATCATAAAAC
TATACCAACTCGATTCATTTATAGGCTGTAAAGGGTTTTA
AAAATCAATTTTAATTCATAAGATTTCAAATAAAGCTAAA
ATGTGGTTATGGAATGGGAAACTGTTATTTGATTCTCACC
ATTCCCTTCACTCTCTAGGGCATTTATTTAAAACCGGGGT
TTTTTCTTCACATATTTATTATGAAAAAGTTTTTGTTACA
AGCAATGTTACTGGGGATATATCTTAAAATTCTGCGATTT
CCGTGTATTAATGGTTGTTTTTAATGTTTGTTTAAAATCT
CTCTGAATTGGGAATGTAATAAATGTTGGAGTAGGATGTT
ATTTTGCTGTTGGGAGGGTAAAAGTGGGAATCGCAGGTTT
AACCTTTTATGTTGTATCGAATAGGATGGAAAGTCAAGAA
GATCAGGCAATGTATGTGTTCAATGTGGTCTTTATAACAT
ACAACTACAAATAAATAATTCCAATGCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations