header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4455
Transcript Name: pdha1a-201
Previous Name: pdha1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019468 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019468|OTTDARG00000016233|ZDB-GENE-040426-2719 pdha1a|OTTDARP00000016473 CH211-114C12.11-001 LG_ AL928875.4 Danio rerio protein_coding KNOWN, 2349 bp
AGAGGGCAGTATTTCCAGAGGAATGCACGGCGAATCTGCA
GCAGCTGTAAACCTCGCTAGCTGGGCTGGTTCTGTGAGTG
GACCGAAGGAGATCACTTTTCTGGTTAGCTGTGGGTTAAT
AGCATGAGAAAGATGCTAACCATAATTTCTAACGTTCTGA
GGGGCGGCGCCAGCAGGAACGGTGCCAGGATTGTGGTATC
TGCCAGGACATATGCAGACTTTACCCCTCAGGCCACCTTT
GATATTAAGAAATGTGACGTGCACAAGCTGGAAGAGGGCC
CAGCAGTGCAGGCAGTGCTAACCAGAGAAGAAGGCCTTCA
ATACTACCGAACAATGCAGACCATGAGGCGCATGGAGCTC
AAAGCTGATCAGCTGTACAAGCAGAAGATCATCAGGGGCT
TCTGTCACCTTTATGATGGACAGGAAGCGTGTGCCGTGGG
TATTGAGGCGGGTATTAATCTATCAGATCATCTCATCACA
GCCTACCGTGCCCACGGGTACACACTCACCAGAGGAGGCA
CCGTTCGGGAGATCATGGCTGAGCTGACTGGTCGTAGAGG
AGGTATTGCCAAAGGAAAGGGAGGGTCAATGCACATGTAC
ACTAAACATTTCTATGGAGGAAATGGAATTGTGGGAGCTC
AGGTGCCTCTTGGGGCGGGTGTAGCGTTGGCCTGCAAATA
CCAGGGCAAGAATGAGCTGTGTGTTTGTCTCTATGGTGAT
GGTGCTGCTAATCAGGGTCAGATCTTTGAAACGTATAATA
TGGCATCTCTGTGGAAGCTGCCGTGCATCTTCATTTGTGA
GAACAACAAATACGGCATGGGTACTTCTGTGGAGAGAGCG
GCCGCTAGTACTGACTACTACAAAAGAGGCGATTTTATCC
CTGGATTGAGGGTGGATGGCATGGATGTTCTTTGTGTGAG
GGAGGCCACCAAATTTGCTGCTGAACACTGCAGATCAGGA
AAGGGTCCTATTCTGATGGAACTGCAGACCTATCGTTATC
ATGGACACAGTATGAGCGACCCAGGAGTCAGCTACCGCAC
ACGTGAGGAGATCCAGGAGGTGCGCAGCAAGAGCGACCCT
ATCTCGTTGCTGAAGGATCGCATGCTGAGCAACAACATGG
CCAGTGTGGAGGAACTGAAGGAGATTGATGTGGAGGTAAG
GAAAGAGATTGAAGACGCAGCTCAGTTTGCCACCACAGAC
CCTGAGCCTCCGCTGGAGGATCTTTGCAACCACATTTTCT
ACAATGACCCTCCTTTGGAAGTGCGTGGCACCAACCCCTG
GTCCAAACTCAAGTCCATCAGCTAAATCTCCTTCATCCTC
CTCTTCCTACTGGTTGGACCCTCTCCTATTAAAACGCACA
GATAAAAATCCTCCCCAGTGTGGCTATAGGTTTCAGAGAC
AGTTATTGGGGAAACTCAGCCAAATCTCCCAGCCACATTG
AGAAAAGTTGCCTCATTTCACATTTGATCATTGCCTTGTT
TTCTTGTCTTCATCAGTTACAACACTAACCCTCAATTTAT
TTTACATCATCTATTGCAAAGAGCATGTACAGTAATATGT
GAATAAACACGGCAGGACTTGGCTTGTAATTATTGGTACT
TTCCAAATGTTTCCAGTACCTCTACAACATCCACACAATG
GCAGAATATTTACTTTGTCCACTCAGACATGCATGCGCTC
ACACATTCACAGCTTTATATATCCGCAGAAGTGTGTGTGT
GTGTGCTTATGTGTGTTTTAGCCAAGGTGTTGGTGAAACG
CAGCCTTGCAGTTTTAGCTTTACAAAACATTTAAAGGGAA
GTGTTTATTAACAGTTAAAATGTAAATCATTGTGGCCATA
CTACAGGAAAAGTTTGTGTTTTTTTGTGGTATCATAAAAC
TATACCAACTCGATTCATTTATAGGCTGTAAAGGGTTTTA
AAAATCAATTTTAATTCATAAGATTTCAAATAAAGCTAAA
ATGTGGTTATGGAATGGGAAACTGTTATTTGATTCTCACC
ATTCCCTTCACTCTCTAGGGCATTTATTTAAAACCGGGGT
TTTTTCTTCACATATTTATTATGAAAAAGTTTTTGTTACA
AGCAATGTTACTGGGGATATATCTTAAAATTCTGCGATTT
CCGTGTATTAATGGTTGTTTTTAATGTTTGTTTAAAATCT
CTCTGAATTGGGAATGTAATAAATGTTGGAGTAGGATGTT
ATTTTGCTGTTGGGAGGGTAAAAGTGGGAATCGCAGGTTT
AACCTTTTATGTTGTATCGAATAGGATGGAAAGTCAAGAA
GATCAGGCAATGTATGTGTTCAATGTGGTCTTTATAACAT
ACAACTACAAATAAATAATTCCAATGCTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdha1a-201 Contained in:
OTHER pdha1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019468 (1)
  • Ensembl_Trans:ENSDART00000023784 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC060928 (1) 2292bp
    GenBank:CF348702 (1) 773bp
    GenBank:BI867263 (1) 630bp
    GenBank:AI721990 (1) 614bp
    GenBank:BE016397 (1) 559bp
    GenBank:BI880586 (1) 519bp
    GenBank:AI353423 (1) 450bp
    GenBank:CB354822 (1) 435bp
    CITATIONS (2)