header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4415
Transcript Name: abca2-202
Previous Names: abca2-001, si:dkey-266h7.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019382 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019382|OTTDARG00000016166|ZDB-GENE-050517-1 abca2|OTTDARP00000016397 DKEY-266H7.1-001 LG_none BX855605.4,BX842685.6 Danio rerio protein_coding NOVEL, 7870 bp
TGGGTTCTTGCATTTGAGATTTTCATCCCATTGGTGCTCT
TCTTCATACTCCTGGGCTTGCGGCAGAAGAAGCCAGCCAT
TCCAGTCAAAGAAGCCTTCTATAGCGCGGCGCCGCTCACC
TCGGCGGGCATCATTCCCATCATGCAGTCGTTGTGTCCGG
ATGGTCAGCGGGATGAGTTTGGCTTCCTGCAGTATAAAAA
CTCCACTGTGACTCAATTGCTGGAAAGGATAAGTGAAGTT
GTGGAGCAGAATCACTTGTTTACATCAGACAGGCCCAGTC
TGGGAGAGGAGCTGGAGTCTCTGCAGCAGCACCTCGAAAG
TCTGAGCTCAGCACAAGGCCCTCTAGAGAGCCACTACAAC
ACCAGCCACGGTTTCACTGTGGGAAGCGTCCTCAGGAACC
AGTCGATGTTCCAGCAGTTTCTGATGCGAAATCTCTCCCT
GCCGAACGACACGTCCAGCCTGCTGCTCTCCTCCCCCGTC
AATCTAAAAGAGGTATATAATCTCATCTTTGGGACGTATC
CCAAAGCGGGATCAAAGGGAGGAGAAAGAGATGAAGGACA
GCACCAACTCAACAGTCCTGGAGAGAAGCTTGTACAGCTG
GAGGGAGTTCTGTTGACTGGTGCAGTGCTTGAAAGCCTTA
CCTGTGGGGAAGGAGGGAACAGTGAGATTGGCAAAATCCT
ATTGGTCCCTGAGAAACAACAGGCGGTTTTACAGGCTTAC
CGCACGACTGTTTGTGGTTTAGGGGCGGGGCAGAGGGCGG
AGCTTTTCAGACAGTTGAGTGAAGAACTGAGAGATCAGAT
TGACACACAGAGAGTCTTTGATCAGTTGCGTCTTGAGCAG
TCTAATATGTCTGGTCTGCTGGATCAGTCCCGTCTCGGGG
CTCTCCTGAAGAACCTGGCTGATGTGGAGCGGCTGCTGAG
GGACGTGGATCTACTGTCAGGTCTGGCCAGACTGCTGCCG
AAAGGGGCCTGTGCGGGTCACCAGCCTCCTCCTCAGGCCA
ACACCACCTCCTGGAGCTCCAACTCTACCACATGGGGTCC
CAATACAACTGACAGTTCTGTGGAGGAAGGAGAAGGAGCT
TCTGAGAGCGAGGCAGAGGCTGAAAACCCCAAATCACAGT
TTTCTGCATTTGTTCAGCTGTGGGCAGGACTTCAACCCAT
ACTTTGTGGGAATAATAGGATTTTCGAACCAGAAGCGCTG
AAACAAGGAAATATGAGTTCTCTGGGCTTCACCAGCAAAG
AACAGAGAAATTTAGGATTACTTGTTCATCTCATGACTAC
AAATCCCAAAATCCTCTACTCTCCCATTGACTCAGAGGTG
GACAAGGCCAATGAGACCTTTGCTTTTGTGGGGAATGTGA
CTCACTATGCCCGTGTGTGGCTCAACATCTCTGCTGAATT
AAGGGCCTTTTTAGAGGAGGGTAAATTGCAAAATCACCTG
ATGTGGCTCCAGCAGTTTATTACCGACCTGAAGAGGCACC
ATGAGCTGCTGAACGTATCAGACAGTGAGCTGATGAACAG
TCTGCTGGAGGAGAACTTCACCCTGCCAAACACAACCACC
TTACTGGAGCAGCTGCACACCATTGATAATGCTGCTTGTG
GATGGACTAACTTCATGTCAAAGGTCAGTGTGGATATCTT
CAGAGGCTTCCCTGATGAAGAAAGCATTGTCAATTACACA
CTGAACCAGGCCTACCACGACAACGTCTCAGTCTTTGCAA
GTGTGATTTTCCAGACCAATAAAGATGGATCCCTGCCACC
CCATGTTATGTATAAAATTCGACAGAACTCGAGCTTTACC
GAGAAAACCAATGAAATCCGACGTGCTTATTGGCGCCCAG
GGCCAAACACAGGCGGCAAATTCTACTTCCTTTATGGCTT
TGTGTGGATCCAAGATATGATTGAACGGGCAATCATCAAC
ACCTTTGTTGGCCACGATGTTGTGGAGCCTGGAAATTACG
TGCAGATGTTTCCTTATCCGTGCTACACCAGAGACGATTT
TCTCTTTGTTATCGAGCACATGATGCCTCTGTGTATGGTC
ATATCCTGGGTCTACTCTGTGGCCATGATGATCCAGCACA
TCGTAGCAGAGAAGGAGCAAAGACTGAAAGAGGTAATGAA
GATGATGGGCTTGAATAACGCAGTGCACTGGGTGGCCTGG
TTCATCACAGGCTTCGTGCAGCTTTCCATCTCAGTGACGG
CCCTCACTGCCATACTGAAATACGGGAAAGTCCTCCTTCA
CAGCGATCCCTTCATCATATGGCTTTTTCTTACAATCTAC
GCTGTCGCAACCATCATGTTCTGTTTCCTGGTGTCGGTGT
TGTACTCTAAAGCCAAACTGGCCTCGGCATGTGGAGGAAT
CATCTACTTCCTGAGTTATGTGCCCTACATGTATGTGGCC
ATAAGAGAAGAGGTGGCTCACGATAAGATCACTGCCTTTG
AGAAGTGCATAGCGTCTTTGATGTCTACCACAGCGTTCGG
TCTGGGATCCAAGTACTTTGCCCTGTATGAAGTGGCTGGC
GTGGGAATTCAGTGGCGCACTATTAACCAGTCACCTGTAG
AGGGCGATGACTTCAATCTACTGCTGTCTATGGTCATGCT
CACTATTGACGCCATTGTATATGGTGTGTTGACCTGGTAT
ATAGAAGCCGTCCATCCAGGGATGTATGGACTGCCTCGGC
CATGGTATTTCCCCTTGCAGAAGTCCTATTGGTTAGGTAG
TGGCCGCATAGAGACGTGGGAGTGGCCGTGGGGTGGAGGC
ACCAGGCTGAGTGTTATGGAAGAGGACCAGGCTTGTGCCA
TGGAGCATAGACGCTCAGAGGAAACCCGTGGAATTGAAGA
AGAGCCCAATCATTTGCCGCTGGTGGTGTGCATCGACAAA
CTGACCAAAGTCTACAAGACGGGCAGCAAACTGGCTCTAA
ACAAGCTGAGCCTGAACCTGCATGAGAACCAGGTTGTCTC
TTTCTTGGGACACAATGGGGCTGGCAAGACCACCACTATG
TCCATTCTCACGGGACTCTTTCCACCCACCTCTGGCTCTG
CCACCATATACGGCCATGACATCCGCACAGAGATGGAGCG
CATCAGGCAGAACTTGGGCATGTGTCCCCAGCACAACGTC
CTGTTTGATAAGCTCAGTGTGGAGGAACATCTGTGGTTCT
ACTCACGGCTGAAAGGCATGGCAGAGGAAGATATTCGCAA
GGAGATGGACAAGATGATAGAGGATCTCGAATTATCTAAT
AAACGTCACAGTCTGGTTCAAACCCTGTCAGGAGGGATGA
AAAGGAAGCTGTCAGTGGCCATTGCTTTTGTAGGTGGGTC
TCGGGCAGTGATTTTGGATGAACCAACAGCAGGAGTAGAC
CCATATGCCCGTCGAGCGATCTGGGACCTCATCCTGAAAT
ATAAGCAAGGTCGCACCATCCTGCTGTCCACTCACCACAT
GGATGAGGCTGATCTGCTGGGTGACCGCATTGCCATCATC
TCTCATGGCAAGCTCAAGTGCTGCGGTTCTCCTCTGTTCC
TCAAGAGCACATATGGAGACGGATACAAACTCACACTTGT
TAAAAAACAGAGTGACTCACACACTGCAGATCAGTCAAGC
CAGTCTCCGTCCTCTTCGATATCTCCATGTTCAGAAAACA
GAGTAACTCAGTTCATCCGTCAGTATGTTGCTTCCTGCCT
GCTGGTGTCCGACTCCAACACTGAACTCTCTTATGTCCTA
CCATCAGAGGCTGTCAAGAAAGGCTGCTTTGAGAGACTCT
TCCAGGCTCTGGAGCAGAGTTTAGACAGCTTGGCCTTGAC
CAGCTTTGGCGTGATGGACACCACATTGGAGGAGGTGTTT
CTAAAGGTGTCAGAAGAAGATCTGTCGCTGGAAAACAGCG
ATGCAGACATGAAGGACTCTCCAGGCGGAGCATCAGCCGG
GAAGCCGTCAGGTCTGTTAGGAGGGCCTCAGTGTGAAGGA
GCTCCAGCCGCTGCTGTGATGAGGCCAGAGGTGGAGCTCA
GCAACCTGATGATGTGCTCCAGGCTGAGCCCAAGCCAAGC
ATCCCTGCAGTCCGGCTCTTCTCTGGGCTCAGTGAGAGGA
GATGAAGGGGGTCCCTATTCTGAGTTCTATGGAGACTATT
GCCCACTGTTTGACAACGGTCAGGATCTGGACTCTGCCAG
TCTCAGAGATGAAGAGTCATCTCCTCAGCCCACTGTACTC
GAGGGCCAGGGCAGCTTCAAGCTCGATGGCTGGTGGCTTA
AACTCCGCCAGTTTCATGGGCTGATCGTGAAAAGGTTTCA
CTGTGCCAAGAGGAACACCAAGGGCATTTTCTCTCAGATT
CTGCTGCCTGCTTTCTTCGTATGTGTGGCAATGACTGTGG
CTCTGTCTGTGCCTGAGATTGGTGACCTTCCTCCCCTGAT
CCTGTCTCCATCTCAATATCACAACTACACACAGCCTCGA
GGAAACTTCATCCCCTACGCCAATGAAGACAGATCTCAAT
ACAGGACTAAGTTTTCTCCAGACGCAGGCCCACAGAGGAT
TGTTAACACCCTCCGTCTGCCATCTGGAGTCGGTGCGACT
TGTATCCTGAAGACTCCCTTTAACAGCACCCTGGACCAAC
TGGCCCAAACTCTCAATCCTTATGCCAACAACTCTAAAAC
CCTGGCAGCCCGCTACTTTGACTCTATGTGCCTGGACTCC
TTCACGCAGGGTGTGCCTTTGTCGAATTTCGTTCCCCCTC
CGCCCTCTCCTGCCCCCTCAGACGACCCGGAGGCTCATTT
TGAAGACGGCCTGTGGAACTACACTGCAGCTCCTACTACT
GTCAGAGAGATGGCCACGTCTCCCCCGACTCTGCCCTTGA
GTATCCATGAGCCGGTGCGCTGTATCTGCTCTATGCAGGG
CACAGGCTTCTCCTGCCCCAGTGGAGTTGGGGGTCGACCT
CCTCTGATGAAAGTGGTGACCGGAGACATCCTGGTGGACA
TTACAGGTCGCAACGTGTCTGAATATCTCCTGTACACGTC
TGATCGGCTCAGGTTACACAGATATGGAGGCTTTACTGTT
GGAAACATTCAGAAATCTGTCCCAGCATCCTTCGGGAGAA
AAACACCACCTATGGTGCGCAAAATAGCAGTTTGTCTTGC
TCTGCAGGTGCTGTATAATAACAAAGGCTATCACAGTATG
CCAACATATCTAAATGTCCTCAACAATGCCATTCTCAGAG
CCAATCTGCCCAGTAGTAAAGGAAACCCTTCTGCATACGG
CATTACAGTGACCAATCATCCCATGAACAGAACCAGTGCC
AGTCTTTCTCTGGATTATCTGCTCCAGGGCACTGATGTGG
TTATTGCCATCTTCATCATTGTAGCCATGTCTTTCGTGCC
TGCGAGCTTTGTGGTCTTTCTGGTAGCGGAAAAATCCACC
AAAGCCAAACACCTGCAGTTTGTCAGCGGATGCGACCCTG
TCACGTACTGGCTAGCAAACTACATATGGGACATGCTGAA
CTACCTGGTTCCAGCTACATGCTGTGTCCTAATTTTGTTT
GTGTTCGACCTTCCTGCGTACACGTCACCTACAAATTTCC
CAGCAGTGCTCTCTCTGTTTCTGCTTTATGGCTGGTCTAT
AACCCCCATCATGTACCCAGCCTCCTTCTGGTTTGAGGTG
CCCAGCACAGCTTATGTTTTCCTCATAGTCATCAATCTCT
TCATTGGCATCACAGCCACGGTGGCCACTTTCCTCCTCCA
GCTGTTTGAGCGCGACAAGGACCTGAAGTTGGTAAACAGC
TACCTGAAGTCATGTTTTCTCATCTTCCCCAACTATAACC
TGGGTCACGGATTGATGGAGATGGCCTATAATGAGTATAT
CAATGAATATTACGCCAAGATAGGCCAGTTTGATAAAGTG
AAGTCTCCATTTGAATGGGACATTGTGACGCGGGGACTGG
TAGCAATGACCATTGAGGGCTTCGTCGGCTTTCTCATTAC
AATTCTGTGCCAGTACAACTTCCTCAGGAAAGCCCAGAGA
GTGCCTGTCAACAGTCAGCCAGTGGAGGACGATGATGTTG
ATGTGGCCTGTGAAAGACGCCGAGTTCTGAGGGGAGACGC
TGACAACGACATGCTGAAGATCGACAACCTAACCAAGGTG
TACAAGTCTCGTAAGATGGGCCGGATCCTGGCAGTGGACC
GATTGTGTCTGGGGGTCCGTCCTGGTGAATGCTTCGGTCT
GCTGGGAGTGAATGGGGCAGGAAAGACCACCACCTTCAAA
ATGTTGACAGGAGATGAGAGCACAACAGGGGGAGAAGCCT
TTATCCAGGAACACAGTATCTTGCGGGAGCTGTTACGTGT
GCAGCAGAGCATCGGTTACTGCCCTCAGTTTGACGCTCTG
TTTGATGATCTGACGGCTCGAGAGCATCTGGAGCTCTACA
CGCGCCTCCGCGGCATCCCATGGAAAGATGAGGAGCGGGT
GGTTCAGTGGGCTTTGGAGAAGTTGGAGTTGTCCAAGTAT
GCCGACAAGCCTGCTGGCACCTACAGCGGAGGCAACAAAC
GCAAACTCTCTACAGCCATTGCTCTGATTGGATACCCATC
GCTCATCTTTTTGGATGAGCCCACCACAGGTATGGACCCA
AAGGCTCGCCGTTTCTTATGGAACCTAATTCTTGACATCA
TCAAGACGGGCCGCTCAGTAGTGTTGACGTCACACAGTAT
GGAGGAGTGTGAAGCGCTGTGCACTAGACTGGGCATCATG
GTTAATGGCAGGTTCAAGTGTCTAGGAAGCATCCAGCATC
TCAAAAACAGATTCGGAGATGGATACATGATAACAGTACG
CACTAAGACCACCGCTAGCGTTAAAGAAGTGATTCGGTTT
TTTAACAGAAATTTTCCTGAGGCAATTCTAAAGGAGCGAC
ACCACACAAAGATTCAGTACCAGCTGAAGTCAGAGAACAT
CTCTCTGGCTCAGGTCTTCAGCAAAATGGAGCAGGTGGTG
GAGGTGCTGAGCATCGAGGATTATTCCGTCAGCCAAACCA
CACTGGATAACGTCTTTGTTAACTTTGCAAAAAAGCAAAG
CGACAACTTAGAGCAGCAAGAAAGTTCTCCATCTAGTGGT
GGCCAGTCGCCACTGCAGCATCTGCTCAGCCTCCTCAGGC
CTCGTCCTGCAAACACTGAGCTCAACGCCCTCGTGAGTGA
AGAGCCTGAGGAACTGGAGAGTGATGATGACGAAGGACTG
ATCAGCTTTGAGGAAGAGAGGGTGCAGTTGTCCTTTAATA
CAGACACTCTGTGCTGAAACTGCTGTTAATCTCACAGACG
GAGAGATGTTCTAATATAAGCCTCAAGTTCAGACCTGTGT
CTGTGTGGTGAAAGACATGTGTACGTTTATTTGTGGTTGG
AGAAGATCCGTCTCTCCGGCCCAGTGAGTGGGTCCTCATT
CTTTCCGTCTGCACAGAACGGCTCTTCTGGACAACAGTCG
AGGCCTGAACGCGATCAGGTCCTCCGTCCACAGCCTCCCC
TCGTGCATTTCGGAGATGACGGTTTATGGAAACGTGTAAA
AAAAAAAAAACTGTACTTCATATTCAAGCCTGCTGGATGG
GAATTAAAGAGAATGTATTTCTTAGAAACAAAAAAAGTGG
CTGTATGGTTTATTTTGGTATCGCTTTAAATTCGAATATG
GTCGTATTATCTTTAAACCGATCGCGTCCGAGTTGTTTTA
ATTGTAGTGTTGATGTCATAACATAATCATCCCTCAAGGA
ATAGGACTTGTTCTTTTATGACTGTTTATCCTCACGTTGG
GTTGTAACTATACATCTTTTTTTCTAGTCTGTTCATTTGG
TACTGCATTGAGAGCATGCTATAAAAGACAAGCCTGTCGT
GTTGTGGGTTGAAGAAATTTTACTATGCTT

abca2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA abca2-002 (1) 475
mRNA abca2-202 7870
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abca2-202 Contained in:
OTHER abca2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000019382 (1)
  • Ensembl_Trans:ENSDART00000141554 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK027706 (1) 738bp
    GenBank:AW232948 (1) 605bp
    GenBank:CK689314 (1) 599bp
    CITATIONS (3)