ZFIN ID: ZDB-TSCRIPT-090929-441
Transcript Name: eif2b4-201
Previous Name: eif2b4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005126 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005126|OTTDARG00000004774|ZDB-GENE-030131-955 eif2b4|OTTDARP00000004636 eif2b4-001 LG_ BX276101.6 Danio rerio protein_coding KNOWN, 2120 bp
AACATGGCGGACTCGGATGGGAGACAGGTTGACAGCATCA
ACCATGCTACAGGTGAAGAAGGGAAGTTGCAAGATATTGT
AAAAGCAAAGAGTGAAGGTAAGGAGTTGACCAAAGAAGAA
AAGCAGCGTCTTAGGAAAGAGAAGAAGCAGCATAAAAAGA
ATAAAAAAGATGACAACAAGGGTCCTCCAGAGAAGGAAAA
GGAGAAGGAAAAAGAGAAAGCATCTGCTCCACCTCCATCA
AAGCCTGTCACCCAGAGCCCGGCACATAAAGCTGCTCCAG
CACCTGTAACTGCATCTGCATCTGAAACTCCTGCGGCTGC
AGAGAAGCCTGCAAAGACCAAAGCAGAGCTGCGAGCAGAG
CGACGGGCACGGCAAGACTCAGAACGAGCATCAAAACAGG
GCAAGAAGGAAGGTGGTCAACAATCCACCTCCAGCAAACC
TAAAGCCTCCCCCAATGAGCTCCAGCCAGTTGTGAAAAGG
TTACCTGAGCACGTTCAGGTGGATGATCCTGCTGCGTTGA
AAAAGTTGGCCAAGAAGCTTGAGCGACAGCAGGTTCCTTT
GAGGTCAGATTATGGTTACAAGGTCAGCCTGTTCTCACAT
CTACATCAATACAGCCGAAAAAACCCTCCCACGCAGCAAA
TCAGCATCCCAGCCACAGTTATTCACCCATCCATTGTTCG
GTTGGGCCTGCAGTACTCTCAGGGCATTATAGCAGGATCC
AATGCTCGATCTGTGGCCCTGCTACATGCCTTCAAACAGG
TTATTCAAGACTATAGCACACCTCCAAACGAGGAGTTGTC
AAGGGACCTTGTGAACAAGCTTTCACCTTATATCAGTTTC
CTCAGCCAGTGTCGGCCTCTGTCTGCCAGCATGGGCAATG
CCATCAAGTACATAAAGAAGGAGATTTCAAATATACCCAA
TCAATGCAAAGAAGAGGAGGCAAAAGGGAAACTGCAGGCA
TGTATTGATAGTTACATAAATGAGAAGATCATTTTGGCTT
CTGAAGCCATTTCTAAATATGCTATTGAGAAGATAAGCAA
TGGAGACGTCATTCTAGTTTACGGCTGCTCGTCACTTGTC
AATCACATTCTGTGCGAAGCCTTTGAGAAGCAGAGGCAGT
TCAGAGTCATAGTTGTGGACAGTCGGCCCAGGTTGGAAGG
TCGAGAGGCGCTGAGGCGTCTGGTGAAGAAAGGCATCCGA
TGTACTTACGTGCTCATTTCTGCCTTGTCCTACATTCTGC
CTGAAGTATCCAAGGTATTTCTCGGTGCTCATGCACTCCT
TGCCAATGGATATGTGATGTCACGTGTTGGAACTTCCCAA
ATTGCCCTGGTAGCAAAGGCCTACAATGTACCAGTGCTGG
TCTGCTGTGAGACCTACAAGTTCTGTGAACGAGTGCAGAC
GGACTCTTTTGTATCCAATGAATTAGATGACCCTGATGAC
CTGATTGTGACCAGAAATGGGAAGACCCACCTAGAGAACT
GGCAGACTGTTAAATCGCTGGGCCTTCTGAACCTGGTGTA
TGATGTGACGCCACCAGACTTTGTGGACCTTGTGATCACC
GATTTGGGCATGATCCCCTGCACCTCTGTGCCTGTGGTAC
TGCGAGTCAAGAATGTAGATCAGTGAAGAGCAGATGCACA
CACTTCCCTCTTGAATCTGTGCGCACAGGGCTTCTGGCAT
GAAACAAACATATCTATCAAATGGAACCAGCTTTTCAAAT
ATAGCTGCTGTTTATGTCCTCATTGGGGGGACTCCATTTC
ATTTTGAACCGCGCAACTGGTCCTATTCTAGATGTGTTTT
TTAAATGACAGTTGGTTTCAGGCAGAACATTCTGAGATCA
GTTCATGAAATTGGTGTAGACACCATGCAGATTGTCAGTA
ATGCATTTTTTGCTTTCAGTTTTGGCCCCTCATGATGGTC
CGTAAATAGACATACACGTTTTAAGAAATATCTATCATCT
TTTTTTCAAGATTACCCATGCCAAAGTCCTTTCATAGATG
TAAAAAAAAGGGAACAGTGCATATGTGTGCGCAAGACCAT
GTTGTACGTATAAGGGGTTTGGTTTATATGACCAAAACCT
TAGAAATGCTACAAGAAAATAAATGGTTTAGATTAAAAAA

eif2b4 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA eif2b4-002 (1) 794
eif2b4-004 (1) 639
mRNA eif2b4-201 2120
eif2b4-203 (1) 578
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eif2b4-201 Contained in:
OTHER eif2b4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005126 (1)
  • Ensembl_Trans:ENSDART00000125830 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC091878 (1) 2150bp
    GenBank:CK363484 (1) 819bp
    GenBank:CF998218 (1) 813bp
    GenBank:CK237516 (1) 780bp
    GenBank:BM183436 (1) 672bp
    GenBank:AI477407 (1) 649bp
    GenBank:BI562775 (1) 587bp
    GenBank:BI892030 (1) 581bp
    GenBank:AI477692 (1) 461bp
    GenBank:CB359738 (1) 452bp
    CITATIONS (2)